Báo cáo khoa học: "Development of a novel antigen capture-ELISA using IgY against porcine interleukin-6 and its application" potx
... 337–343 Development of a novel antigen capture-ELISA using IgY against porcine interleukin-6 and its application Deog Yong Lee, Young Wook Cho, Sang Gyun Kang, Sung Jae Shin, Han Sang Yoo* Department of Infectious ... interferon-gamma in response to mitogen, superantigen and recall viral antigen. Vet Immunol Development of a novel antigen capture-ELISA...
Ngày tải lên: 07/08/2014, 18:20
... 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA- 1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for the former, and LTA–M2F, 5¢-CAGCTGTTTTGCTTGAATTATG-3¢ and LTA–2R, 5¢-GAATTCATTATGTTTCAGGTTCA GGGG-3¢ for the latter. The ... organ-specific blood vascular and lymphatic endothelial cells of the mouse Takashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura, Nobuaki Yoshida...
Ngày tải lên: 18/02/2014, 17:20
... Purandare AV, Chen Z, Huynh T, Pang S, Geng J, Vaccaro W, Poss MA, Oconnell J, Nowak K & Jayar- aman L (2008) Pyrazole inhibitors of coactivator associ- ated arginine methyltransferase 1 (CARM1). ... Only AMI-1 and AMI-6 demonstrated selectivity for the PRMTs, although AMI-6 was mini- mally active against a cellular PRMT substrate [8]. Computational modeling suggested that AMI-1 s...
Ngày tải lên: 06/03/2014, 11:20
Báo cáo khoa học: Construction of a novel detection system for protein–protein interactions using yeast G-protein signaling pdf
... AAACGCCTTCGCCCAAAGTTTAAAAGATGA 22 TCATCTTTTAAACTTTGGGCGAAGGCGTTT 23 TTTTCTCGAGAAAGATGCCGATTTGGGCGC 24 GGGGCTCGAGGTTTTATATTTGTTGTAAAA 25 ATATTATATATATATATAGGGTCGTATATA 26 AAATTATAGAAAGCAGTAGA TAAAACAATG 27 ... CCCGCTCGAGTCTTAGAATTATTGAGAACG 3 GCCCGGATCCTGATAGTAATAGAATCCAAA 4 CCCCGAATTCAAATTATAGAAAGCAGTAGA 5 AAGGCTCGAGAGATCTGTTTAGCTTGCCTC 6 AAAAGTCGACGAGCTCGTTTTCGACACTGG 7 TTTTGTCGACATGGCGCAACA...
Ngày tải lên: 16/03/2014, 01:20
Báo cáo khoa học: Characterization of a novel long-chain acyl-CoA thioesterase from Alcaligenes faecalis docx
... USA. Bacterial strain The strain isolated from soil samples was identified as a bacterium, A. faecalis according to Bergey’s Manual [31], and was designated A. faecalis ISH108. The strain has ... 3.90 and 7.20, and 2.84 and 5.51 for cis-vaccenoyl- CoA. Whereas the affinity and catalytic efficiency of Al- caligenes thioesterase were reduced by about twofold for palmitoleoyl-CoA a...
Ngày tải lên: 16/03/2014, 13:20
Báo cáo khoa học: "Development of a Stemming Algorithm" pdf
... Chicago, Department of Lin- guistics. variety of applications are considered in evaluating the theoretical and practical attributes of several previous algorithms. As a major part of its ... problem and of this report as a whole. After a word in the library user's query has been stemmed and a matching stem and associated list of full-word forms has...
Ngày tải lên: 16/03/2014, 19:20
Báo cáo khoa học: Development of a baculovirus-based fluorescence resonance energy transfer assay for measuring protein–protein interaction potx
... (5¢-CCTGTCAGATCTCCGCCAT GGCTAACAATGCATCTCT-3¢), and a BamHI site (bold) was introduced into the reverse primer (5¢-TCTCC CGGATCCAAAGAGAAATACCCATA-TA-3¢) to facili- tate vector–insert ligation. Amplification ... of one LTa and two LTbs, and a LTa2b1 complex contains two LTas and one LTb.By simply adjusting the relative ratio of infection between the two recombinant baculoviruses...
Ngày tải lên: 30/03/2014, 20:20
Báo cáo khoa học: " Development of a sandwich ELISA for the detection of Listeria spp. using specific flagella antibodies" potx
... at RT. After adding ABTS (KPL, USA) and 30 min’s incubation at RT, absorbance was measured at 405 nm. Sandwich ELISA The sandwich ELISA was performed on microtiter plates. Each well was coated ... incubated for 30 min at RT and washed three times with PBS. Antigen- antibody reaction was visualized by adding ABTS to each well and the absorbance was checked at 405 nm using ELISA plate...
Ngày tải lên: 07/08/2014, 18:21
Báo cáo khoa học: "Development of a Lightcycler-based reverse transcription polymerase chain reaction for the detection of foot-and-mouth disease virus" pps
...
Ngày tải lên: 07/08/2014, 18:21