Báo cáo khoa học: " Persistent occurrence of a single Streptococcus equi subsp. zooepidemicus clone in the pig and monkey population inIndonesia" ppsx

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx

... The Authors Journal compilation ê 2009 FEBS Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary ... Restriction site W11F WT W11F CA CCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoI W168F WT W168F GAACCTTTATTCGCTATT GGTACCGGTAAA KpnI WT* W11F W11F ⁄ W168F...

Ngày tải lên: 18/02/2014, 11:20

15 635 0
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf

... proteins contained in aggregates within the otolith matrix and identified a protein contained in the HMW protein glycosaminoglycan aggregate that also contains the otolith structural protein otolin-1. This ... digestion of genomic DNA con- tamination in the total RNA was confirmed by lack of amplification of a b-actin mRNA fragment by PCR using a pair of primers...

Ngày tải lên: 18/02/2014, 17:20

12 569 0
Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

Tài liệu Báo cáo khoa học: Spectroscopic characterization of a higher plant heme oxygenase isoform-1 from Glycine max (soybean) ) coordination structure of the heme complex and catabolism of heme docx

... nm, and at the same time, distinct absorption bands of oxyheme appeared at 540 and 579 nm. Then, a broad band appeared at around 660 nm, and was maximal 9–12 min after initiation of the reaction. ... vanished after 30 min, and instead, an absorption peak appeared at 637 nm, suggesting the formation of CO–verdoheme. The 637 nm band disappeared gradu- ally and was repl...

Ngày tải lên: 19/02/2014, 05:20

16 618 0
Tài liệu Báo cáo khoa học: Crystal structures of a bacterial 6-phosphogluconate dehydrogenase reveal aspects of specificity, mechanism and mode of inhibition by analogues of high-energy reaction intermediates pdf

Tài liệu Báo cáo khoa học: Crystal structures of a bacterial 6-phosphogluconate dehydrogenase reveal aspects of specificity, mechanism and mode of inhibition by analogues of high-energy reaction intermediates pdf

... Crystal structures of a bacterial 6-phosphogluconate dehydrogenase reveal aspects of specificity, mechanism and mode of inhibition by analogues of high-energy reaction intermediates Ramasubramanian ... suite: programs for protein crystallo- graphy. Acta Crystallogr D Biol Crystallogr 50, 760–763. 28 Navaza J (1994) Amore – an automated package for mo...

Ngày tải lên: 19/02/2014, 05:20

12 452 0
Tài liệu Báo cáo khóa học: New activities of a catalytic antibody with a peroxidase activity ppt

Tài liệu Báo cáo khóa học: New activities of a catalytic antibody with a peroxidase activity ppt

... abzymes; nitrosoalcanes; microperoxidase 8; S-oxidation. Catalytic antibodies with a metalloporphyrin cofactor, or ÔhemoabzymesÕ, are not as efficient a category of catalysts as their natural hemoprotein ... set of six monoclonal antibodies was thus obtained: the best peroxidase activity – that found with the complex of MP8 and one of those antibodies, 3A3 – was character...

Ngày tải lên: 19/02/2014, 12:20

7 448 0
Tài liệu Báo cáo khoa học: Crystal structure of a subtilisin-like serine proteinase from a psychrotrophic Vibrio species reveals structural aspects of cold adaptation docx

Tài liệu Báo cáo khoa học: Crystal structure of a subtilisin-like serine proteinase from a psychrotrophic Vibrio species reveals structural aspects of cold adaptation docx

... subtilisin-like serine proteinase from a psychrotrophic Vibrio species reveals structural aspects of cold adaptation Jo ´ hanna Arno ´ rsdo ´ ttir 1 , Magnu ´ s M. Kristja ´ nsson 2 and Ralf Ficner 1 1 Abteilung ... glycosylase from Atlantic cod (Gadus morhua) reveals cold- adaptation features. Acta Crystallogr Sect D 59, 1357–1365. 10 Aghajari N, Van Petege...

Ngày tải lên: 19/02/2014, 16:20

14 597 0
Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

Tài liệu Báo cáo khoa học: Specific targeting of a DNA-alkylating reagent to mitochondria Synthesis and characterization of [4-((11aS)-7-methoxy-1,2,3,11a-tetrahydro-5H-pyrrolo[2,1-c][1,4]benzodiazepin-5-on-8-oxy)butyl]-triphenylphosphonium iodide doc

... alkyla- tion leading to a depletion of mtDNA in intact cells (Fig. 1). Here we report the synthesis and characterization of a novel mitochondria- targeted alkylating reagent and show that it alkylates ... should also alkylate mtDNA within mitochondria and cells. MitoDC-81 does not alkylate mtDNA in isolated mitochondria Having ascertained that mitoDC-81 was sequeste...

Ngày tải lên: 20/02/2014, 11:20

10 639 0
Tài liệu Báo cáo khoa học: "Human Evaluation of a German Surface Realisation Ranker" docx

Tài liệu Báo cáo khoa học: "Human Evaluation of a German Surface Realisation Ranker" docx

... Computational Linguistics Human Evaluation of a German Surface Realisation Ranker Aoife Cahill Institut făur Maschinelle Sprachverarbeitung (IMS) University of Stuttgart 70174 Stuttgart, Germany aoife.cahill@ims.uni-stuttgart.de Martin ... evaluation metrics cannot be avoided, but ideally, a metric for the evaluation of realisation rankers would rank alternative real-...

Ngày tải lên: 22/02/2014, 02:20

9 480 0
Báo cáo khoa học: Structural evidence of a-aminoacylated lipoproteins of Staphylococcus aureus pot

Báo cáo khoa học: Structural evidence of a-aminoacylated lipoproteins of Staphylococcus aureus pot

... the structure of N-terminal lipids of native S. aureus lipoproteins. Here, we provide solid structural evidence for N-acylated triacyl forms of SitC and four other lipoproteins in S. aureus RN4220 ... lipoprotein from S. aureus is triacylated [15]; however, we could not show structural evidence of N-acylation of the lipoprotein. In addition, some triacylated lipopr...

Ngày tải lên: 06/03/2014, 01:20

13 407 0
Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

Báo cáo khoa học: Functional analysis of a murine monoclonal antibody against the repetitive region of the fibronectin-binding adhesins fibronectin-binding protein A and fibronectin-binding protein B from Staphylococcus aureus pot

... - FnBPB-1 FnBPB-2/3 FnBPB-4 FnBPB-5 FnBPB-6 FnBPB-7 FnBPB-8 FnBPB-9 FnBPB-10 FnBPB-11 GST FnBRB FnBPB-1 FnBPB-2/3 FnBPB-4 FnBPB-5 FnBPB-6 FnBPB-7 FnBPB-8 FnBPB-9 FnBPB-10 FnBPB-11 GST FnBRA FnBPA-1 FnBPA-2 FnBPA-3 FnBPA-4 FnBPA-5 FnBPA-6 FnBPA-7 FnBPA-8 FnBPA-9 FnBPA-10 FnBPA-11 GST FnBRA A < /b> 490 ... - FnBPB-1 FnBPB-2/3 FnBPB-4 FnBPB-5 FnBPB-6 FnBPB-7 FnBPB-8 FnBPB-9 FnBPB-10 FnBPB-11 G...

Ngày tải lên: 06/03/2014, 22:21

16 561 0
Báo cáo khóa học: Identification of a gene encoding Lon protease from Brevibacillus thermoruber WR-249 and biochemical characterization of its thermostable recombinant enzyme pptx

Báo cáo khóa học: Identification of a gene encoding Lon protease from Brevibacillus thermoruber WR-249 and biochemical characterization of its thermostable recombinant enzyme pptx

... kDa), and carbonic anhydrase (29 kDa)] is shown as the standard curve. The molecular mass of native Bt -Lon (s)was estimated from the standard curve based on the elution volume of native Bt -Lon and ... b- D -thio- galactoside (Fig. 3, lanes 2 and 3). SDS/PAGE analysis indicated that the recombinant protein was a single band of  90 kDa after purification by affinity and g...

Ngày tải lên: 16/03/2014, 16:20

11 505 0
Báo cáo khoa học: Heteromer formation of a long-chain prenyl diphosphate synthase from fission yeast Dps1 and budding yeast pptx

Báo cáo khoa học: Heteromer formation of a long-chain prenyl diphosphate synthase from fission yeast Dps1 and budding yeast pptx

... FEBS Heteromer formation of a long-chain prenyl diphosphate synthase from fission yeast Dps1 and budding yeast Coq1* Mei Zhang, Jun Luo, Yuki Ogiyama, Ryoichi Saiki and Makoto Kawamukai Department ... Okada K, Kainou T, Tanaka K, Nakagawa T, Matsuda H & Kawamukai M (1998) Molecular cloning and mutational analysis of the ddsA gene encoding decapre- nyl...

Ngày tải lên: 30/03/2014, 04:20

16 315 0
Báo cáo khoa học: " Persistent occurrence of a single Streptococcus equi subsp. zooepidemicus clone in the pig and monkey population inIndonesia" ppsx

Báo cáo khoa học: " Persistent occurrence of a single Streptococcus equi subsp. zooepidemicus clone in the pig and monkey population inIndonesia" ppsx

... causative agent of the various pig and monkey infections on the island of Bali and the other islands of Indonesia [15]. These findings raises the question whether the bacterial clone discovered in ... described outbreak among the pig and monkey population on the island of Bali, Indonesia. These findings indicate that the mucoid growing S. equi s...

Ngày tải lên: 07/08/2014, 18:20

3 314 0
báo cáo khoa học: " Granulomatous infiltration of a parathyroid adenoma presenting as primary hyperparathyroidism in a woman: a case report" ppt

báo cáo khoa học: " Granulomatous infiltration of a parathyroid adenoma presenting as primary hyperparathyroidism in a woman: a case report" ppt

... 21:438-441. doi:10.1186/1752-1947-4-400 Cite this article as: Anaforoğlu et al.: Granulomatous infiltration of a parathyroid adenoma presenting as primary hyperpara thyroidism in a woman: a case report. Journal of Medical Case Reports ... Medical Case Reports 2010, 4:400 http://www.jmedicalcasereports.com/content/4/1/400 Page 4 of 4 CASE REPO R T Open A...

Ngày tải lên: 11/08/2014, 02:22

4 158 0
w