0
  1. Trang chủ >
  2. Luận Văn - Báo Cáo >
  3. Báo cáo khoa học >

Báo cáo khoa học: " A comparative study of gastrointestinal parasites between ranched and free ranging Burchell''''''''s zebra (Equus burchelli antiquorum) in Isiolo district, Kenya" ppsx

Báo cáo khoa học:

Báo cáo khoa học: " A comparative study of gastrointestinal parasites between ranched and free ranging Burchell''''s zebra (Equus burchelli antiquorum) in Isiolo district, Kenya" ppsx

... overall infection rate. Two of the ranched animals had the nematode, Setaria equina. Eachhad 3 parasites. 70% of the free ranging zebra were infectedwith the same nematode and numbers ranged ... large intestines thereforeappear to be an important portion of the gastrointestinal tract asfar as parasitism in zebras is concerned.All zebra examined were infected with at least 3 genera ... and 37oE and latitudes 0o10' and 0o17'N.The area is dry and hot for most of the year. Rainfal1 isunreliable and scarce; however the two main rainfal1seasons are the long rains...
  • 6
  • 453
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Comparative Study of Parameter Estimation Methods for Statistical Natural Language Processing" potx

... 465-472. Andrew, G. and Gao, J. 2007. Scalable training of L1-regularized log-linear models. In ICML. Charniak, E. 2000. A maximum-entropy-inspired parser. In NAACL, 132-139. Charniak, E. and ... 2007.c2007 Association for Computational Linguistics A Comparative Study of Parameter Estimation Methods for Statistical Natural Language Processing Jianfeng Gao*, Galen Andrew*, Mark Johnson*&, ... epochs, and N is the number of training samples. 3 Evaluations From the four tasks we consider, parsing and lan-guage model adaptation are both examples of re-ranking. In these tasks, we assume...
  • 8
  • 504
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Comparative Study of Hypothesis Alignment and its Improvement for Machine Translation System Combination" pot

... Micciulla, and J. Makhoul. 2006. A study of translation edit rate with targeted human annotation. In Proceeding of AMTA. T. Takezawa, E. Sumita, F. Sugaya, H. Yamamoto, and S. Yamamoto. 2002. ... Toward a broad-coverage bilingual corpus for speech translation of travel conversations in the real world. In Proceeding of LREC-2002, Las Palmas de Gran Canaria, Spain. D. Xiong, Q. Liu and ... from Machine Translation Systems. In Proceeding of EMNLP. Hawaii, US, Oct. F. Huang and K. Papinent. 2007. Hierarchical System Combination for Machine Translation. In Proceed-ings of the...
  • 8
  • 546
  • 1
Báo cáo khoa học:

Báo cáo khoa học: "A Comparative Study of Reinforcement Learning Techniques on Dialogue Management" pdf

... onDialogue ManagementAlexandros PapangelisNCSR ”Demokritos”,Institute of Informatics& Telecommunications and Univ. of Texas at Arlington,Comp. Science and Engineeringalexandros.papangelis@mavs.uta.eduAbstractAdaptive ... years ADShave seen a lot of progress and have attracted theresearch community’s and industry’s interest.There is a number of available ADS, apply-ing state of the art techniques for adaptation ... onlinelearning RL algorithms on the dialogue manage-ment problem, in the presence of uncertainty and changes in the environment.Atkeson and Santamaria (1997) evaluate modelbased and model free...
  • 10
  • 498
  • 0
Báo cáo khoa học: A comparative study of methylglyoxal metabolism in trypanosomatids potx

Báo cáo khoa học: A comparative study of methylglyoxal metabolism in trypanosomatids potx

... (Tc00.1047053510659.240) wasamplified by PCR from genomic DNA using the sense pri-mer 5¢-AAGCTTATGTCAACACGACGACTTATGCAC A- and the antisense primer 5¢-GGATCCGGATCCTTAAGCCGTTCCCTGTTC-3¢ with additional HindIII and BamHI ... S, Bhattacharyya N,Ray M & Ray S (2006) In vivo assessment of toxicity and pharmacokinetics of methylglyoxal – augmentation of the curative effect of methylglyoxal on cancer-bear-ing mice ... and bloodstream parasites results in a complete glyoxalasesystem.Implications for parasite chemotherapyMammalian cells maintain a repertoire of four path-ways for metabolism of methylglyoxal [33],...
  • 11
  • 639
  • 0
Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot

Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot

... ATATATCATATGTCCGGTGTCGCAAAGR-TryX ATATAGGATCCTTACTCGTCTCTCCACGGF-TryP1 ATATATCATATGTCCTGCGGTAACGCCR-TryP1 ATATAGGATCCTTACTGCTTGCTGAAGTATCF-TDPX1 Cys35Ala CAACGTAGCCAGCAAGGCCGGCTTCACCAAGGGCGR-TDPX1 Cys35Ala ... codons of the mutated amino acids are in bold.Cloned protein or mutation primer (5’- to 3’)F-TDPX1 TATATCATATGTCTATCTACGACTTCAAGGTCR-TDPX1 ATATAGGATCCTCACGATTGAGTGCTTGGF-TryX ATATATCATATGTCCGGTGTCGCAAAGR-TryX ... CGCCCTTGGTGAAGCCGGCCTTGCTGGCTACGTTGF-TDPX1 Cys64Ala GGTACTGGCGTTCCCGGCCAACCAGTTCGCCGGTCR-TDPX1 Cys64Ala GACCGGCGAACTGGTTGGCCGGGAACGCCAGTACCF-TDPX1 Cys83Ala AGGTGAAAAGTTTCGCCGCCACGCGTTTCAAGGCTGAGR-TDPX1...
  • 16
  • 483
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A Comparative Study of Target Dependency Structures for Statistical Machine Translation" ppt

... Bleu: a method for automatic evalu-ation of machine translation. In Proceedings of ACL,pages 311–318.Adam Pauls and Dan Klein. 2011. Faster and smallern-gram language models. In Proceedings of ... 619-0237 Japanwuxianchao@gmail.com,sudoh.katsuhito@lab.ntt.co.jp,kevinduh@is.naist.jp,{tsukada.hajime,nagata.masaaki}@lab.ntt.co.jpAbstractThis paper presents a comparative study of target dependency ... 114–119,Plainsboro.Ryan McDonald and Joakim Nivre. 2011. Analyzing and integrating dependency parsers. ComputationalLinguistics, 37(1):197–230.Ryan McDonald, Koby Crammer, and Fernando Pereira.2005. Online large-margin...
  • 5
  • 410
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "A comparative study of Sephadex, glass wool and Percoll separation techniques on sperm quality and IVF results for cryopreserved bovine semen" pptx

... membrane integrity was evaluated by CFDA/PI fluorescent staining and HOST [24]. It has been reported that vital stains such as CFDA/PI fluorescent stain are used to evaluate physical plasmalemma ... rates were also reevaluated by calculating blastocyst production of cleaved embryos as well as total oocytes.Statistical analysisStatistical analysis of data was performed by SPSS 15.0 software. ... h in an atmosphere of saturated humidity and 5% CO2. After maturation, COCs were washed with BO medium containing 5 mM caffeine sodium benzoate, 10 μg/mL of heparin, and 10 mg/mL of BSA...
  • 7
  • 496
  • 2
Báo cáo khoa học:

Báo cáo khoa học: "A Comparative Study on Generalization of Semantic Roles in FrameNet" ppt

... questionanswer classification. In Proceedings of ACL-07,pages 776–783.Srini Narayanan and Sanda Harabagiu. 2004. Ques-tion answering based on semantic structures. In Pro-ceedings of Coling-2004, pages ... discriminativereranking. In Proceedings of the 43rd Annual Meet-ing on Association for Computational Linguistics,pages 173–180.Massimiliano Ciaramita and Yasemin Altun. 2006.Broad-coverage ... Computational Linguis-tics, 28(3):245–288.Ana-Maria Giuglea and Alessandro Moschitti. 2006.Semantic role labeling via FrameNet, VerbNet and PropBank. In Proceedings of the 21st InternationalConference...
  • 9
  • 549
  • 0
Tài liệu Báo cáo khoa học: A comparative analysis of the time-dependent antiproliferative effects of daunorubicin and WP631 pdf

Tài liệu Báo cáo khoa học: A comparative analysis of the time-dependent antiproliferative effects of daunorubicin and WP631 pdf

... high AnnexinV-Fluosstaining and low propidium-iodide staining are clearly more abundantafter treatment with daunorubicin (D).Fig. 4. Quantitative determination of the uptake of daunorubicin and WP631 ... treatment [1]. Anthracycline anti-biotics are DNA intercalators [2,3], and the antitumoractivity of daunorubicin, a prominent member of this group of antibiotics, may be associated with its binding ... phase contrast and fluorescence photo-graphs of selected field of cells obtained under the samemagnification and contrast acquisition characteristics, and using the autofluorescence of the anthracycline...
  • 7
  • 581
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnbáo cáo khoa học về cá trabáo cáo khoa học nghiên cứu chôm chômtrạng thái hiện sinh báo cáo khoa họcbiểu tượng văn học báo cáo khoa họctài liệu báo cáo khoa họccách trình bày báo cáo khoa họcbáo cáo khoa học toán họccách làm báo cáo khoa họctrình bày báo cáo khoa họcBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018chuyên đề điện xoay chiều theo dạngGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtNguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015HIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM