Báo cáo khoa học: " A comparative study of gastrointestinal parasites between ranched and free ranging Burchell''''''''s zebra (Equus burchelli antiquorum) in Isiolo district, Kenya" ppsx

Báo cáo khoa học: " A comparative study of gastrointestinal parasites between ranched and free ranging Burchell''''s zebra (Equus burchelli antiquorum) in Isiolo district, Kenya" ppsx

Báo cáo khoa học: " A comparative study of gastrointestinal parasites between ranched and free ranging Burchell''''s zebra (Equus burchelli antiquorum) in Isiolo district, Kenya" ppsx

... overall infection rate. Two of the ranched animals had the nematode, Setaria equina . Each had 3 parasites. 70% of the free ranging zebra were infected with the same nematode and numbers ranged ... large intestines therefore appear to be an important portion of the gastrointestinal tract as far as parasitism in zebras is concerned. All zebra examined were infected with...

Ngày tải lên: 07/08/2014, 18:20

6 454 0
Báo cáo khoa học: "A Comparative Study of Parameter Estimation Methods for Statistical Natural Language Processing" potx

Báo cáo khoa học: "A Comparative Study of Parameter Estimation Methods for Statistical Natural Language Processing" potx

... 465-472. Andrew, G. and Gao, J. 2007. Scalable training of L 1 -regularized log-linear models. In ICML. Charniak, E. 2000. A maximum-entropy-inspired parser. In NAACL, 132-139. Charniak, E. and ... 2007. c 2007 Association for Computational Linguistics A Comparative Study of Parameter Estimation Methods for Statistical Natural Language Processing Jianfeng Gao * ,...

Ngày tải lên: 08/03/2014, 02:21

8 505 0
Báo cáo khoa học: "A Comparative Study of Hypothesis Alignment and its Improvement for Machine Translation System Combination" pot

Báo cáo khoa học: "A Comparative Study of Hypothesis Alignment and its Improvement for Machine Translation System Combination" pot

... Micciulla, and J. Makhoul. 2006. A study of translation edit rate with targeted human annotation. In Proceeding of AMTA. T. Takezawa, E. Sumita, F. Sugaya, H. Yamamoto, and S. Yamamoto. 2002. ... Toward a broad-coverage bilingual corpus for speech translation of travel conversations in the real world. In Proceeding of LREC-2002, Las Palmas de Gran Canaria, Spain...

Ngày tải lên: 17/03/2014, 01:20

8 547 1
Báo cáo khoa học: "A Comparative Study of Reinforcement Learning Techniques on Dialogue Management" pdf

Báo cáo khoa học: "A Comparative Study of Reinforcement Learning Techniques on Dialogue Management" pdf

... on Dialogue Management Alexandros Papangelis NCSR ”Demokritos”, Institute of Informatics & Telecommunications and Univ. of Texas at Arlington, Comp. Science and Engineering alexandros.papangelis@mavs.uta.edu Abstract Adaptive ... years ADS have seen a lot of progress and have attracted the research community’s and industry’s interest. There is a number of available ADS...

Ngày tải lên: 17/03/2014, 22:20

10 499 0
Báo cáo khoa học: A comparative study of methylglyoxal metabolism in trypanosomatids potx

Báo cáo khoa học: A comparative study of methylglyoxal metabolism in trypanosomatids potx

... (Tc00.1047053510659.240) was amplified by PCR from genomic DNA using the sense pri- mer 5¢-AAGCTTATGTCAACACGACGACTTATGCAC A- 3¢ and the antisense primer 5¢-GGATCCGGATCCTT AAGCCGTTCCCTGTTC-3¢ with additional HindIII and BamHI ... S, Bhattacharyya N, Ray M & Ray S (2006) In vivo assessment of toxicity and pharmacokinetics of methylglyoxal – augmentation of the curative effect...

Ngày tải lên: 23/03/2014, 06:20

11 640 0
Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot

Báo cáo khoa học: A comparative study of type I and type II tryparedoxin peroxidases in Leishmania major pot

... ATATAT CATATGTCCGGTGTCGCAAAG R-TryX ATATA GGATCCTTACTCGTCTCTCCACGG F-TryP1 ATATAT CATATGTCCTGCGGTAACGCC R-TryP1 ATATA GGATCCTTACTGCTTGCTGAAGTATC F-TDPX1 Cys35Ala CAACGTAGCCAGCAAG GCCGGCTTCACCAAGGGCG R-TDPX1 Cys35Ala ... codons of the mutated amino acids are in bold. Cloned protein or mutation primer (5’- to 3’) F-TDPX1 TATAT CATATGTCTATCTACGACTTCAAGGTC R-TDPX1 ATATA GGATCCTCACGATTGAGTGCTT...

Ngày tải lên: 23/03/2014, 07:20

16 484 0
Báo cáo khoa học: "A Comparative Study of Target Dependency Structures for Statistical Machine Translation" ppt

Báo cáo khoa học: "A Comparative Study of Target Dependency Structures for Statistical Machine Translation" ppt

... Bleu: a method for automatic evalu- ation of machine translation. In Proceedings of ACL, pages 311–318. Adam Pauls and Dan Klein. 2011. Faster and smaller n-gram language models. In Proceedings of ... 619-0237 Japan wuxianchao@gmail.com,sudoh.katsuhito@lab.ntt.co.jp, kevinduh@is.naist.jp,{tsukada.hajime,nagata.masaaki}@lab.ntt.co.jp Abstract This paper presents a comparativ...

Ngày tải lên: 30/03/2014, 17:20

5 411 0
Báo cáo khoa học: "A comparative study of Sephadex, glass wool and Percoll separation techniques on sperm quality and IVF results for cryopreserved bovine semen" pptx

Báo cáo khoa học: "A comparative study of Sephadex, glass wool and Percoll separation techniques on sperm quality and IVF results for cryopreserved bovine semen" pptx

... membrane integrity was evaluated by CFDA/PI fluorescent staining and HOST [24]. It has been reported that vital stains such as CFDA/PI fluorescent stain are used to evaluate physical plasmalemma ... rates were also reevaluated by calculating blastocyst production of cleaved embryos as well as total oocytes. Statistical analysis Statistical analysis of data was performed by SPSS 15....

Ngày tải lên: 07/08/2014, 23:22

7 497 2
Báo cáo khoa học: "A Comparative Study on Generalization of Semantic Roles in FrameNet" ppt

Báo cáo khoa học: "A Comparative Study on Generalization of Semantic Roles in FrameNet" ppt

... question answer classification. In Proceedings of ACL-07, pages 776–783. Srini Narayanan and Sanda Harabagiu. 2004. Ques- tion answering based on semantic structures. In Pro- ceedings of Coling-2004, pages ... discriminative reranking. In Proceedings of the 43rd Annual Meet- ing on Association for Computational Linguistics, pages 173–180. Massimiliano Ciaramita and Yasemin Altu...

Ngày tải lên: 17/03/2014, 01:20

9 550 0
Tài liệu Báo cáo khoa học: A comparative analysis of the time-dependent antiproliferative effects of daunorubicin and WP631 pdf

Tài liệu Báo cáo khoa học: A comparative analysis of the time-dependent antiproliferative effects of daunorubicin and WP631 pdf

... high AnnexinV-Fluos staining and low propidium-iodide staining are clearly more abundant after treatment with daunorubicin (D). Fig. 4. Quantitative determination of the uptake of daunorubicin and WP631 ... treatment [1]. Anthracycline anti- biotics are DNA intercalators [2,3], and the antitumor activity of daunorubicin, a prominent member of this group of antibiotics, may b...

Ngày tải lên: 20/02/2014, 23:20

7 582 0
w