Báo cáo khoa học: "Gastrointestinal impaction by Parascaris equorum in a Thoroughbred foal in Jeju, Korea" potx

Báo cáo khoa học: "Gastrointestinal impaction by Parascaris equorum in a Thoroughbred foal in Jeju, Korea" potx

Báo cáo khoa học: "Gastrointestinal impaction by Parascaris equorum in a Thoroughbred foal in Jeju, Korea" potx

... P. equorum in foals, weanlings and yearlings can lead to small intestinal impaction, particularly after the administration of a high efficacy anthelmintic such as ivermectin, piperazine or an ... commonly in the duodenum and proximal jejunum and they may be throughout the entire gastrointestinal tract [6] like this case. Ascarid impactions are treated medically with intestinal lubri...

Ngày tải lên: 07/08/2014, 17:23

2 321 0
Báo cáo khoa học: Hydroperoxide reduction by thioredoxin-specific glutathione peroxidase isoenzymes of Arabidopsis thaliana potx

Báo cáo khoa học: Hydroperoxide reduction by thioredoxin-specific glutathione peroxidase isoenzymes of Arabidopsis thaliana potx

... AtGPX2 (CATATGGCGGATGAATC TCCAA ⁄ GGATCCTCCTCCTCCTGGTGAT), AtGPX5 (CATATGGGTGCTTCATCATCAT ⁄ GG ATCCCTGTG CGTGTTCACAA) and AtGPX6 (CATATGGC AGC AGAGAAGTCTG ⁄ GGATCCAGTTATCCAGATTGAA) without transit ... (CATATGGGA GGAGCTTTATC ⁄ GGATCCGCGTTAACAATGCTCA) and Trx h3 (CATATGGAAGAGAAGCCGCA ⁄ GGATCC AAATCAAGCAGCAGC) proteins were amplified by RT- PCR with chimeric primers (in parenthesis) introducin...

Ngày tải lên: 16/03/2014, 12:20

9 414 0
Báo cáo khoa học: "Serial Combination of Rules and Statistics: A Case Study in Czech Tagging" potx

Báo cáo khoa học: "Serial Combination of Rules and Statistics: A Case Study in Czech Tagging" potx

... regular (paradigm-internal) casual (lexical) The regular (paradigm-internal) ambiguities occur within a paradigm, i.e. they are common to all lexemes belonging to a particular in ection class. ... the HMM tagger outputs a sequence of tags according to the usual equation where and The tagger has been trained in the usual way, using part of the training data as heldout data for smoothi...

Ngày tải lên: 08/03/2014, 05:20

8 519 0
Báo cáo khoa học: Kinetic studies and molecular modelling attribute a crucial role in the specificity and stereoselectivity of penicillin acylase to the pair ArgA145-ArgB263 pdf

Báo cáo khoa học: Kinetic studies and molecular modelling attribute a crucial role in the specificity and stereoselectivity of penicillin acylase to the pair ArgA145-ArgB263 pdf

... dominant substrate binding fragments of PA. In addition, substrates with leaving groups lacking local sym- metry may have their polar group directed towards ArgB263. In this case calculated interaction ... data for the PA–substrate inter- actions in the transition state are missing and only a GRID computational modelling approach to the tetrahedral inter- mediate in PA presents some...

Ngày tải lên: 16/03/2014, 16:20

8 439 0
Báo cáo khoa học: "SVM Model Tampering and Anchored Learning: A Case Study in Hebrew NP Chunking" pdf

Báo cáo khoa học: "SVM Model Tampering and Anchored Learning: A Case Study in Hebrew NP Chunking" pdf

... et al., 227 actively look for such cases by training an SVM chunker on anchored data (as the anchored data is guaranteed to be linearly separable, we can set avery high value to the C parameter, ... when adapting results established in English to another language: (1) acquiring high quality anno- tated data; (2) adapting the English task definition to the nature of a different language,...

Ngày tải lên: 23/03/2014, 18:20

8 507 0
Báo cáo khoa học: Predicting the substrate specificity of a glycosyltransferase implicated in the production of phenolic volatiles in tomato fruit pptx

Báo cáo khoa học: Predicting the substrate specificity of a glycosyltransferase implicated in the production of phenolic volatiles in tomato fruit pptx

... Fragariaxananassa UGT78D1 A. thaliana UGT8 6A1 A. thaliana UGT8 7A1 A. thaliana UGT8 3A1 A. thaliana UGT8 2A1 A. thaliana UGT8 5A1 A. thaliana SbHMNGT S. bicolor UGT76D1 A. thaliana UGT76E1 A. thaliana S39507 ... thaliana OsSGT1 O. sativa UGT74F1 A. thaliana UGT74F2 A. thaliana NtGT2 N. tabacum UGT75C1 A. thaliana UGT75B1 A. thaliana UGT75D1 A. thaliana UGT84B1 A. thaliana UGT8...

Ngày tải lên: 28/03/2014, 23:20

11 661 0
Báo cáo khoa học: Relaxin-3⁄ insulin-like peptide 7, a neuropeptide involved in the stress response and food intake Masaki Tanaka pptx

Báo cáo khoa học: Relaxin-3⁄ insulin-like peptide 7, a neuropeptide involved in the stress response and food intake Masaki Tanaka pptx

... subunits (A- chain and B-chain) linked by disulfide bonds. Relaxin-3 is so named because it has a motif that can interact with the relaxin receptor. By contrast to other relaxins, relaxin-3 is mainly ... Hida T, Takahashi E, Shikata K, Hirohashi T, Sawai T, Seiki T, Tanaka H, Kawai T, Ito O, Arai T et al. (2006) Chronic intracerebroventricular administration of relaxin-3 increases body w...

Ngày tải lên: 29/03/2014, 21:20

8 370 0
Báo cáo khoa học: "Mutation and overexpression of p53 as a prognostic factor in canine mammary tumors" pptx

Báo cáo khoa học: "Mutation and overexpression of p53 as a prognostic factor in canine mammary tumors" pptx

... study, a total of 20 cases were examined, among which there were 5 malignant mixed tumors, 4 mammary gland adenocarcinomas, 1 papillary adenocarcinoma, 8 benign mixed tumors and 2 mammary gland adenomas. ... p53 inactivation occurred prior to invasion in breast carcinogenesis, with mutations being uniformly identified in ductal carcinoma in situ associated with p53 -mutated invasive...

Ngày tải lên: 07/08/2014, 17:22

7 326 0
Báo cáo khoa học: "Thickness of cumulus cell layer is a significant factor in meiotic competence of buffalo oocytes" potx

Báo cáo khoa học: "Thickness of cumulus cell layer is a significant factor in meiotic competence of buffalo oocytes" potx

... giving maximum transmittance at 405 nm. An oocyte was classified as degenerated if the nuclear material was scattered in the ooplasm indicating spindle damage. Statistical analysis Data for meiotic development ... among all groups was analyzed by chi square procedure using Statistix Analytical Software, Tallahassee, FL, USA. Results A total of 588 oocytes were aspirated from 755 ovaries...

Ngày tải lên: 07/08/2014, 18:20

5 370 0
Tài liệu Báo cáo khoa học: Analysis of proteins and peptides on a chromatographic timescale by electron-transfer dissociation MS ppt

Tài liệu Báo cáo khoa học: Analysis of proteins and peptides on a chromatographic timescale by electron-transfer dissociation MS ppt

... of a basic amino acid. The resulting radical anion abstracts a proton and gen- erates a radical site that triggers dissociation to pro- duce a complementary pair of fragment ions of type c¢ and ... from a protein that elutes at 34 min [peak II in (A) ], $ 3 min after peak I. Spectra in (C) and (D) contain an identical set of type z¢ Æ ions. Ions of type c¢ in the two spectra d...

Ngày tải lên: 18/02/2014, 16:20

8 579 0
w