Báo cáo khoa học: " Identification of a putative cellular receptor 150 kDa polypeptide for porcine epidemic diarrhea virus in porcine enterocytes" pps

Báo cáo khoa học: " Identification of a putative cellular receptor 150 kDa polypeptide for porcine epidemic diarrhea virus in porcine enterocytes" pps

Báo cáo khoa học: " Identification of a putative cellular receptor 150 kDa polypeptide for porcine epidemic diarrhea virus in porcine enterocytes" pps

... Communication Identification of a putative cellular receptor 150 kDa polypeptide for porcine epidemic diarrhea virus in porcine enterocytes Jin Sik Oh, Dae Sub Song and Bong Kyun Park* Department of ... that APN is a common receptor for coronavirus group I [6,29]. Interestingly, feline APN (fAPN) acts as a common receptor for coronavirus in grou...

Ngày tải lên: 07/08/2014, 17:22

7 463 0
Báo cáo khoa học: Isolation of a putative peroxidase, a target for factors controlling foot-formation in the coelenterate hydra docx

Báo cáo khoa học: Isolation of a putative peroxidase, a target for factors controlling foot-formation in the coelenterate hydra docx

... Suetake, T., Tsuda, S., Kawabata, S., Miura, K., Iwanaga, S., Hikichi, K., Nitta, K. & Kawano, K. (2000) Chitin-binding pro- teins in invertebrates and plants comprise a common chitin- binding ... active as a single component of 43–45 kDa. Characterization of hydra’s peroxidase activities by gel electrophoresis In situ staining of whole mounts of hydra had shown that a...

Ngày tải lên: 08/03/2014, 10:20

10 389 1
Báo cáo khoa học: "Identification of a novel germ-line mutation in the TP53 gene in a Mexican family with Li-Fraumeni syndrome" doc

Báo cáo khoa học: "Identification of a novel germ-line mutation in the TP53 gene in a Mexican family with Li-Fraumeni syndrome" doc

... Mexican origin. The index case was a 23-year-old female diagnosed with breast carci- noma of the left breast with combined histological fea- tures of lobular carcinoma and infiltrating ductal carcinoma. ... coding for the DNA binding domain [11]. Epidemiological studies estimate that approximately 70% of males and 100% of females who inherit a TP53 mutation are at increased risk...

Ngày tải lên: 09/08/2014, 04:21

7 403 0
Báo cáo khoa học: Improvement of a monopartite ecdysone receptor gene switch and demonstration of its utility in regulation of transgene expression in plants pdf

Báo cáo khoa học: Improvement of a monopartite ecdysone receptor gene switch and demonstration of its utility in regulation of transgene expression in plants pdf

... 5¢-AAG GCT TAC CAC GAG CAG CTA TCA-3¢; reverse, 5¢-ACA GGC CAT GTA CTT TCC GTG TCT-3¢) and tobacco (forward, 5¢-ATG AGA GAG TGC ATA TCG AT-3¢; reverse, 5¢-TTC ACT GAA GGT GTT GAA-3¢) a- tubulin- specific ... stop codon for easy cloning in the forward and reverse primers, respectively (forward, 5¢-ctc gag ATG AAG AGA ACA CAT TTG GCA-3¢; reverse, 5¢-gag ctc TTA GAG GTA GCC TAG TCG AAG-3¢)....

Ngày tải lên: 16/03/2014, 06:20

16 454 0
Báo cáo khoa học: Connection of transport and sensing by UhpC, the sensor for external glucose-6-phosphate in Escherichia coli ppt

Báo cáo khoa học: Connection of transport and sensing by UhpC, the sensor for external glucose-6-phosphate in Escherichia coli ppt

... Germany). The radioactivity was quantified in a Canberra-Packard Tricarb-2500 counter. The kinetic constants of transport were estimated using the method of Hanes. All data represent means of at least three ... Glc6P can be transported by a molecule that is locked in the inducing conformation and which argues against the transport of Glc6P causing an inducing conformation. For...

Ngày tải lên: 08/03/2014, 08:20

8 412 0
Báo cáo khoa học: Retention of the duplicated cellular retinoic acid-binding protein 1 genes (crabp1a and crabp1b) in the zebrafish genome by subfunctionalization of tissue-specific expression doc

Báo cáo khoa học: Retention of the duplicated cellular retinoic acid-binding protein 1 genes (crabp1a and crabp1b) in the zebrafish genome by subfunctionalization of tissue-specific expression doc

... aa 60 aa 38 aa 16 aa 5828 bp 3262 bp 23 aa 60 aa 38 aa 16 aa 7629 bp 6815 bp 7470 bp 23 aa 60 aa 38 aa 16 aa 1959 bp 3453 bp 1222 bp 23 aa 60 aa 38 aa 16 aa 554 bp 2277 bp 4313 bp 23 aa 60 aa ... designed based on cDNA sequences of the zebrafish crabp 1a (5¢-TGAAAG CTCTCGGCGTAAAC-3¢,5¢-GAAC GATGACTACAGC AATGG-3¢) and crabp1b (5¢-GATTTGAAAGCAAGAGG GTC-3¢,5¢-CTGCAAGTGCTGGAATATTC-3¢). The reac...

Ngày tải lên: 16/03/2014, 22:20

11 313 0
Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx

Tài liệu Báo cáo khoa học: Modulation of a-synuclein aggregation by dopamine in the presence of MPTP and its metabolite pptx

... (Govt. of India) for partial financial support. The authors thank Dinesh Kumar for recording the scan- ning electron micrographs and Shivcharan Prasad and Pinakin Makwana for technical assistance. References 1 ... damage [33,34]. The co-administration of antioxidants like coenzyme Q and creatine has also been shown to be beneficial against a- synuclein aggregation in the substantia...

Ngày tải lên: 14/02/2014, 19:20

11 754 0
Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

Tài liệu Báo cáo khoa học: Comparison of a coq7 deletion mutant with other respiration-defective mutants in fission yeast doc

... GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGC cyc1-y GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTG cyc1-z GCATCAGAAAGCATAGGC cyc1-m TGGGAATACGATAGAGTAG nb2 primer GTTTAAACGAGCTCGAATTC Coq7 in fission yeast R. ... GGGGATCCGTCGACCTGCAGCGTACGACATACTACTTCATTTG Spcoq3-y GTTTAAACGAGCTCGAATTCATCGATCCTAGCGTTACCGTTG Spcoq3-z GTATGCGATGTGGAATTTG Spcoq3-m GATGCCTTCCAATGAATTAC cyc1-w GAACCAATGAAATAAGGGCG cyc1...

Ngày tải lên: 18/02/2014, 14:20

16 646 0
Tài liệu Báo cáo khoa học: Structure of the putative 32 kDa myrosinase-binding protein from Arabidopsis (At3g16450.1) determined by SAIL-NMR docx

Tài liệu Báo cáo khoa học: Structure of the putative 32 kDa myrosinase-binding protein from Arabidopsis (At3g16450.1) determined by SAIL-NMR docx

... (excitation at 320 nm). Tetrasialyl PA glycan Neu5Aca2-6Galb1-4GlcNAcb1-2Mana1-6(Neu5- Aca2-3Galb1-3(Neu5Aca2-6)GlcNAcb1-4(Neu5Aca2-6Galb1- 4GlcNAcb1-2)Ma na1-3)Manb1-4GlcNAcb1-4GlcNA-PA was used as a ... Neu5Aca2-6Galb1-4GlcNAcb1-2Mana1- 6(Neu5Aca2-3Galb1-3(Neu5Aca2-6)GlcNAcb1-4(Neu5Aca2- 6Galb1-4GlcNAcb1-2)Mana1-3)Manb1-4GlcNAcb1-4Glc- NAc-PA were obtained from Takara Bio. Inc. (Otsu, Shi...

Ngày tải lên: 18/02/2014, 14:20

12 579 0
Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

Tài liệu Báo cáo khoa học: Development of a new method for isolation and long-term culture of organ-specific blood vascular and lymphatic endothelial cells of the mouse pdf

... tsA58T Ag cDNA carry- ing the A4 38V mutation were PCR-amplified from COS-7 cDNAs using the following primers: LTA-1F, 5¢-CTC GAGATGGATAAAGTTTTAAACAGAG-3¢ and LTA- 1R, 5¢-TGAAGGCAAATCTCTGGAC-3¢ for ... organ-specific blood vascular and lymphatic endothelial cells of the mouse Takashi Yamaguchi, Taeko Ichise, Osamu Iwata, Akiko Hori, Tomomi Adachi, Masaru Nakamura, Nobuaki Yoshida and Hirot...

Ngày tải lên: 18/02/2014, 17:20

11 873 0
w