Báo cáo khoa học: "Effects of Combination Dietary Conjugated Linoleic Acid with Vitamin A (Retinol) and Selenium on the Response of the Immunoglobulin Productivity in Mice" pdf

... ADE and selenium on immunoglobulin production. Effects of Combination Dietary Conjugated Linoleic Acid with Vitamin A (Retinol) and Selenium on the Response of the Immunoglobulin Production in ... 2000, 64(10) , 2159-2164. Effects of Combination Dietary Conjugated Linoleic Acid with Vitamin A (Retinol) and Selenium on...

Ngày tải lên: 07/08/2014, 17:22

... 2007. Large language mod- els in machine translation. In Proceedings of the 2007 Joint Conference on Empirical Methods in Nat- ural Language Processing and Computational Natu- ral Language Learning ... eval- uation of machine translation. In Proceedings of 40th Annual Meeting of the Association for Computational Linguistics, pages 311–318, Philadelphia, Pennsylva- nia,...

Ngày tải lên: 07/03/2014, 22:20

... equally in design of the study, col- lection of data and drafting the manuscript; SB and XJ worked on analysis of data; FX provided the conception of this study and the final approval of the ... equivalent to the motion of the spinal column. Data from literatures have confirmed that in conformal radiotherapy, intra-fraction organ/target motion can be achi...

Ngày tải lên: 09/08/2014, 09:22

... Forward Reverse ATCGTGCGTGACATTAAGGAGAAG AGGAAGGAAGGCTGGAAGAGTG 179 NM_001101 b 1 -AR 60 Forward Reverse GGGAGAAGCATTAGGAGGG CAAGGAAAGCAAGGTGGG 270 NM_000684 b 2 -AR 60 Forward Reverse CAGCAAAGGGACGAGGTG AAGTAATGGCAAAGTAGCG 334 ... Murakami A, Aggarwal BB: Zerumbone abolishes NF-κB and InBa kinase activation leading to suppression of antiapoptotic and metastatic gene expression, upregu...

Ngày tải lên: 09/08/2014, 09:20

... reduced and the upstream kinases of MAPK and MAPKK are only slightly activated and can sequester only limited fractions of MAPK and MAPKK. Discussion The function of the signal transduction network ... downstream pathways are capable of adaptation. Figure 3A shows the dynamics of the co- valent modification cycle for a fast kinase with low affinity and a slo...

Ngày tải lên: 19/02/2014, 07:20

... methylation donor in the PRMT reaction, the use of SAM analogs is a logical strategy for the direct inhibition of PRMTs. As a SAM analog, sinefungin can compete for SAM binding and inhibit the activity ... elevates PRMT activity and cellular protein arginine methylation, including methyl- ation of the guanine nucleotide exchange factor Vav1 [5]. Incubation with MDL...

Ngày tải lên: 06/03/2014, 11:20

... parsing approach called PARIS (parsing using indexing and search). We start by presenting a model for parsing ASR 1-best and extend the ap- proach to consider ASR lattices. 4.1 Query Parsing on ASR ... 97.4% Table 3: Parsing performance using the PARIS approach Data Sets SearchTerm Extraction Accuracy LocationTerm Extraction Accuracy Input ASR WCN Oracle Transcription ASR WCN Orac...

Ngày tải lên: 08/03/2014, 21:20

... standard deviations of five independent determinations). Fluorescence due to nonproteasomal degradation was subtracted. The asterisks indicate data points that are statistically significant as ... existence of additional TQ-binding sites on the proteasome. Figure 4 indicates that the formation of b-subunit–TQ adducts increases at TQ concentrations of 5 and 20 lm, whereas it de...

Ngày tải lên: 15/03/2014, 11:20

... zinc atom in the protease domain and a phos- phate group in the helicase domain are also visible. The interface region between the helicase and the protease domains is framed and shown in detail in ... [8–13]. Nevertheless, we are interested in determining the functional importance of the helicase domain for the activity and inhibition of the protease...

Ngày tải lên: 16/03/2014, 06:20

... conformation of this loop. Changes in the conformation of the backbone at this point and changes in the orientation of other side chains, as a result of the introduction of the large charged aspar- tate ... the w ⁄ / angles at position 157 are in a region of the Rama- chandran plot that is allowed only for glycine. Substi- tuting any amino acid at this...

Ngày tải lên: 16/03/2014, 06:20