Báo cáo khoa học: " Estimation of Paratuberculosis Prevalence in Dairy Cattle in a Province of Korea using an Enzyme-linked Immunosorbent Assay: Application of Bayesian Approach" ppt

... Dairy Cattle in a Province of Korea using an Enzyme-linked Immunosorbent Assay: Application of Bayesian Approach Son-il Pak*, Doo Kim and Mo Salman1 Department of Veterinary Medicine, Kangwon National ... fixation ELISA Intradermal skin test Absorbed ELISA － Estimation of Paratuberculosis Prevalence in Dairy Cattle in a Province of Korea...

Ngày tải lên: 07/08/2014, 17:22

... estimated either from variance analysis in case of hierarchical sampling (Issaux) after arc-sinus square-root transformation (OPEP program, Baradat, 1985) or using the G-test in the ... beginning and the length of the flowering period vary according to annual climatic conditions. This can induce inter- annual variations of phenological gaps and...

Ngày tải lên: 08/08/2014, 19:21

... from the first thinnings are lack- ing) available to them. This situation justi- fies the development of an alternative approach to that of Assmann and Franz (1963). Objectives The ... bark) begins only at a dominant height of 4 m, the total yield can be calculated at a given dominant height, by fixing the lower limit of the integral at...

Ngày tải lên: 08/08/2014, 19:21

... Saraburi 18180 Thai- land. *** Correspondence and reprints ACKNOWLEDGMENTS The authors thank MD Meagher, DGW Edwards and SA Barnes for reviewing the manuscript and KP Brady ... on random mating in a clonal seed orchard of Pi- cea mariana. Silvae Genet 31, 90-94 Reynolds S, El-Kassaby YA (1990) Parental bal- ance in Douglas-fir seed orchard cone...

Ngày tải lên: 08/08/2014, 23:22

... Solubilization of water-unextractable arabinoxylan (WU-AX) (A) and oat spelt xylan (OSX) (B) by B. subtilis xylanase mutants with a modified secondary binding site and of water-unextractable arabinoxylan ... 3. Binding of B. subtilis xylanase mutants with a modified secondary binding site to water-unextractable arabinoxylan (WU-AX) (A) and oat spelt xylan (OSX) (B) and of A. niger...

Ngày tải lên: 14/02/2014, 19:20

... Stephanou A, Isenberg DA, Nakajima K & Latchman DS (1999) Signal transducer and activator of transcrip- tion-1 and heat shock factor-1 interact and activate the transcription of the Hsp-70 and ... CTTTCCCCAAGTGCTCCTCCTA Antisense GGGTTATGTTAGCTCAGTTACAGTA pGL70()405) Sense TGGACGCGCGTAACCCGCAC Antisense GGGTTATGTTAGCTCAGTTACAGTA pGL70()298) Sense GCGCTGAAGCGCAGGCGGTCA Antisense GGGTT...

Ngày tải lên: 18/02/2014, 06:20

... repressed by alphaVbeta3 integrin in human breast cancer cells. Matrix Biol 26, 291–305. 9 Oh J, Takahashi R, Kondo S, Mizoguchi A, Adachi E, Sasahara RM, Nishimura S, Imamura Y, Kitayama H, Alexander ... RI, El-Gewely SA, Andersen K, Maelandsmo GM & Win- berg JO (2003) Colchicine induces membrane-associated activation of matrix metalloproteinase-2 in osteosar- coma cells in an...

Ngày tải lên: 18/02/2014, 11:20

... one of the most ancient and versatile cofactors of several impor- tant class of proteins and have been implicated in vari- ety of functions [29,30]. Iron and sulfur can be combined in several ways ... for resistance to intracellular killing, the scavenging of free radicals and the reactivation of degenerated proteins during infection by a family of proteins named ‘thio- re...

Ngày tải lên: 18/02/2014, 12:20

... (RRM), double-stranded RNA-binding domain (dsRBD) and Piwi Argonaut and Zwille (PAZ), represents an RNA-binding domain. These domains are usually linked to larger globular enzymatic domains, such as nucleases ... hepatic cells are important players in the in ammatory processes initiated in response to a variety of agents, including viral or bacterial infections, thermal and mechani...

Ngày tải lên: 18/02/2014, 14:20

... Higuchi et al. [30] to obtain cDNAs encoding M25L–elafin and M63L–trap- pin. For this purpose, forward primers 5¢-CGACTCGA GAAAAGAGCGCAAGAGCCAGTCAA-3¢ and 5¢-CGAC TCGAGAAAAGAGCTGTCACGGGAGTTCCT-3¢ ... wild-type elafin and trappin [15]. Each of the molecules migrated as a single band at 7 kDa (M25L–elafin) and 12 kDa (M63L–trappin) in a reducing SDS ⁄ PAGE gel, indicating homogeneity of...

Ngày tải lên: 19/02/2014, 07:20