Báo cáo toán học: "Evaluation of a Multiple Integral of Tefera via Properties of the Exponential" pot
... distribution, and these moments are all integers. the electronic journal of combinatorics 15 (2008), #N29 3 Evaluation of a Multiple Integral of Tefera via Properties of the Exponential Distribution Yaming ... using calculus and basic probability. General recursions for a class of such integrals are derived and associated combinatorial identities are mentioned. 1 B...
Ngày tải lên: 07/08/2014, 15:22
... values of Feynman diagrams.) Through the Feynman diagrams of quantum field theory there is even a “link” to knot theory: some Feynman diagrams can be associated to knots (see [12]), so that the values ... form ζ (a, a, a) can be directly evaluated from the permutation formulas alone; with the use of Theorem 2 and the two-dimensional reflection formula (3) it is easy to see t...
Ngày tải lên: 07/08/2014, 06:20
... Probe 5'- /5HEX/TGCGGTCACCATCAATGAAGAGCA/3IABkFQ/ -3' Primer 1 5'- CGCAATCATAGGACTAGAGACG -3' Primer 2 5'- GATCCTGTATTCGGCTTCCAG -3' Table 2: Primary Antibodies ... CAC CAT CAATGA AGA GCA /3IABkFQ/-3' Primer 1 5'-CGC AAT CAT AGG ACT AGA GAC G-3' Primer 2 5'-GAT CCT GTATTC GGCTTC CAG-3' NCR1 Assay ID Hs.PT.1994249 Probe 5&ap...
Ngày tải lên: 19/06/2014, 22:20
Báo cáo hóa học: " Research Article A Cohen Type Inequality for Fourier Expansions of Orthogonal Polynomials with a Nondiscrete Jacobi-Sobolev Inner Product" potx
... Fourier Expansions of Orthogonal Polynomials with a Nondiscrete Jacobi-Sobolev Inner Product Bujar Xh. Fejzullahu 1 and Francisco Marcell ´ an 2 1 Department of Mathematics, Faculty of Mathematics and Natural ... 4, the authors established the asymptotics of the zeros of such Jacobi-Sobolev polynomials. The aim of our contribution is to obtain a lower bound for the...
Ngày tải lên: 21/06/2014, 07:20
Báo cáo hóa học: " Research Article A Strong Limit Theorem for Weighted Sums of Sequences of Negatively Dependent Random Variables" potx
... Journal of Inequalities and Applications work was supported by the National Natural Science Foundation of China 11061012 ,the Support Program of the New Century Guangxi China Ten-hundred-thousand ... negatively dependent random variable, Ph.D. thesis, 2000. 6 V. Fakoor and H. A. Azarnoosh, “Probability inequalities for sums of negatively dependent random variables,” Pakistan...
Ngày tải lên: 21/06/2014, 07:20
Báo cáo sinh học: " Research Article A Gaussian Mixture Approach to Blind Equalization of Block-Oriented Wireless Communications Frederic Lehmann (EURASIP Member)" doc
... final ISI state of the current data burst to a known value. At the same time, this also sets the initial ISI state of the next data burst to the same known value. Since blind equalization is of ... algorithm based on a Gaussian mixture parameterization of the a posteriori probability density function (pdf) of the transmitted data and the channel. The performan...
Ngày tải lên: 21/06/2014, 16:20
báo cáo hóa học:" SimReg1 is a master switch for biosynthesis and export of simocyclinone D8 and its precursors" docx
... CCATGTAGGCGGTGACGA simA7F TAAAGCTTCAAAACGGGGTGAAC DNA-shift assay P A7 simA7R ATAAGCTTGTCGATACCGATCTTC PEx2F ACTTCCCAGAAGTA DNA-shift assay P Ex2 PEx2R AGAGGGCAGTAGAC PR3F TTTCTAGATGCACCCGATCCTC ... TAGAATTCCGCGGTTCGGCAGA simX5D3F TAGAATTCTGTACAAGGCCTGGT DNA-shift assay P D3 simX5D3R TAGAATTCGCGACAGGAGCCATA simEXX4F TAGAATTCGACGCCTTCCAGTC DNA-shift assay P X4 simEXX4R TAGAATTCTCAGAACATCGTCC...
Ngày tải lên: 21/06/2014, 17:20
báo cáo hóa học:" Research Article A Reinforcement Learning Based Framework for Prediction of Near Likely Nodes in Data-Centric Mobile Wireless Networks" pdf
... a data track table to maintain the data transfer information. The advantage of the runtime update of near likely node is that the data is stored on either the collector node itself or its near ... wireless data. One of the approaches in data-centric storage is that the nodes that collected data will transfer their data to other neighboring nodes that store the similar...
Ngày tải lên: 21/06/2014, 18:20
báo cáo hóa học:" Research Article A New Multithreaded Architecture Supporting Direct Execution of Esterel" docx
... Systems Reset a0 0 a1 1 a0 1 a1 0 a1 2 a2 3 a3 4 a4 3 a4 2 a3 2 a3 1 a2 1 a2 0 a3 0 a4 1 a4 0 a2 2 a3 3 a4 4 A0 A1 A2 A3 A4 (a) State Description: A0 : Abort empty (no ABORT loaded) A1 : Abort Level 1 (AASR1 and AAAR1 loaded ... 1st ABORT) A2 : Abort Level 2 (AASR2 and AAAR2 loaded with 2nd ABORT) A3 : Abort Level 3 (AASR3 and AAAR3 loaded with 3rd ABORT) A4 :...
Ngày tải lên: 21/06/2014, 20:20
Báo cáo hóa học: " Research Article A Hybrid Projection Algorithm for Finding Solutions of Mixed Equilibrium Problem and Variational Inequality Problem" pptx
... nonlinear mappings in Hilbert space,” Journal of Mathematical Analysis and Applications, vol. 20, pp. 197–228, 1967. 3 F. E. Browder, “Nonexpansive nonlinear operators in a Banach space,” Proceedings ... Proceedings of the National Academy of Sciences of the United States of America, vol. 54, pp. 1041–1044, 1965. 4 K. Goebel and W. A. Kirk, A fixed point theorem for asymp...
Ngày tải lên: 21/06/2014, 20:20