Báo cáo khoa học: "Development and Evaluation of a New Apparatus for Continuous Perfusion of Isolated Perfused Pig Heart" ppt
... heart fibrillated and stopped * : pacemaker on at the frequency of 110 from 50 minutes of perfusion Development and Evaluation of a New Apparatus for Continuous Perfusion of Isolated Perfused Pig ... heart fibrillated and stopped * : pacemaker on at the frequency of 110 from 50 minutes of perfusion Development and Evaluation of a New Appara...
Ngày tải lên: 07/08/2014, 15:20
... possible fea- Development and Evaluation of a Broad-Coverage Probabilistic Grammar of English-Language Computer Manuals Ezra Black John Lafferty Salim Roukos <black I j laff ] roukos>*watson, ... of application domain. • Development of a manually-bracketed corpus (tree- bank) of the domain. • Creation of a grammar with a large coverage of a blind test...
Ngày tải lên: 08/03/2014, 07:20
...
Ngày tải lên: 07/08/2014, 18:21
Báo cáo khoa học: "Constituent-Based Morphological Parsing: A New Approach to the Problem of Word-Recognition" pdf
... Ngarrka-ngku.ka marlu marna-kurra luwa.rnu ngarni.nja-kurra (man-ergative-aux kangaroo grass-obj shoot-past eat-infmitive-obj) 'The man is shooting the kangaroo while it is eating grass.' ... namely prosody and the non- isomorphism of syntactic and phonological structure. We maintain that these are are central to the task of a morphological analyzer and, hence, ha...
Ngày tải lên: 08/03/2014, 18:20
Báo cáo khoa học: "Contents and evaluation of the first Slovenian-German online dictionary" doc
... Slovenian- German and German-Slovenian online dictionary and contains evaluation fig- ures for its Slovenian part. Evaluations are based on coverage of a Slovenian newspaper corpus as well as on user queries. 1 ... singular form of verbs; • common conversational phrases and multi- word expressions as well as some contextual examples of words and grammatical forms. Grammar...
Ngày tải lên: 17/03/2014, 22:20
Báo cáo khoa học: " Development and Use of a Gold-Standard DataSet for Subjectivity Classifications" pdf
... shows a four-category data configu- 247 Development and Use of a Gold-Standard Data Set for Subjectivity Classifications Janyce M. Wiebet and Rebecca F. Bruce:[: and Thomas P. O'Harat tDepartment ... reliably annotated gold standard to support experimenting with such applications. This research is also a case study of ana- lyzing and improving manual tagging t...
Ngày tải lên: 23/03/2014, 19:20
báo cáo hóa học: " Development and evaluation of a computer-based medical work assessment programme" pdf
... Main and second activities Status CA1 CA MA1, SA MA, SA1 MA, SA MA, SA MA, SA Event +CA2 +SA +MA2 + SA2 +CA -SA -MA Result CA1 stop CA → MA MA1 stop SA1 stop MA stop SA stop MA stop CA2 start SA ... SA start MA2 start SA2 start SA stop MA → CA SA stop CA start SA → CA CA start CA = Central Activity (no second activity). MA = M ain Activity. SA = S econd Activity. Journal of Occupational M...
Ngày tải lên: 20/06/2014, 00:20
Báo cáo hóa học: " Development and evaluation of one step single tube multiplex RT-PCR for rapid detection and typing of dengue viruses" pdf
... consensus primers (D1: 5' TCAATATGCTAAAACGCGCGAGAAACCG 3' and D2: 5' TTGCACCAACAGTCAATGTCTTCAGGTTC 3'). Dengue Nested PCR The nested PCR assay was performed according to the pro- tocol ... forward primer (D1), and four serotype specific reverse primers (Ts1: 5' CGTCTCAGTGATCCG- GGGG 3', Ts2: 5'CGCCACAAGGGCCATGAACAG 3', Ts3: 5' TAACATCATCATGAGAC...
Ngày tải lên: 20/06/2014, 01:20
báo cáo hóa học:" Development and evaluation of a clinical algorithm to monitor patients on antiretrovirals in resource-limited settings using adherence, clinical and CD4 cell count criteria" ppt
... not for citation purposes) Table 1: Univariate analysis of variables associated with viral failure in 496 Ugandans on ART at the Infectious Diseases Institute, Kampala, Uganda Variable Total ... Mandalia, Jessica Oyugi, Rose Naluggya, Ali Taylor, Petra Schaefer, David Thomas, Keith McAdam and all the staff of the Adult Infectious Disease Clinic and the Academic Alliance. The study...
Ngày tải lên: 20/06/2014, 08:20
Tài liệu Báo cáo khoa học: "Liars and Saviors in a Sentiment Annotated Corpus of Comments to Political debates" pdf
... where a multiplicity of sentiments for a variety of topics and corresponding targets are potentially involved (Riloff and Wiebe., 2003; Sarmento et al., 2009). Alternative approaches to automatic ... Conference and Empiri- cal Methods in Natural Language Processing, Canada. 568 Proceedings of the 49th Annual Meeting of the Association for Computational Linguistics:s...
Ngày tải lên: 20/02/2014, 05:20