Báo cáo khoa học: "Lymphosarcoma in a brown bear (Ursus arctos)" ppsx

... lymphosarcoma in a brown bear (Ursus arctos). To the author’s knowledge, this is the first such case reported in Korea. The animal was a 7-year-old male brown bear (Ursus arctos) that had been raised ... long-term *Corresponding author Phone: +82-31-290-2749; Fax: +82-31-293-6403 E-mail: daeyong@plaza.snu.ac.kr Short communication Lymphosarcoma in a brown bear...

Ngày tải lên: 07/08/2014, 15:20

... only project in the world that applies (iii) not only as a matter of principle but as actual practice. We will regard a natural language as a set of texts. A translation pair is a pair of texts ... principle of simple transfer can now be formulated as follows: If A translates-as A& apos;, then we will call A& apos; a TN of A. We now call an element s,t of the set def...

Ngày tải lên: 08/03/2014, 18:20

... observer's coming to believe anything. We can now state the correlation between ut- terance form and a speaker's mental state as a domain axiom. Domain Axiom 1 Declaratives and Imperatives: ... declarative mood utterances, and then the illocutionary act definitions for request- ing and asserting. Finally, we combine the vari- ous analyses natural language processor'...

Ngày tải lên: 17/03/2014, 20:20

...

Ngày tải lên: 07/08/2014, 17:22

... the data, analysed the results and drafted the article. MS was involved in critically revising the draft. JG made substantial contributions to the data analysis. GB was substantially involved in ... were classified as those causing an increase in patient monitoring, a change in vital signs but without associated harm or a need for treatment or increased length of stay. Major error...

Ngày tải lên: 25/10/2012, 10:39

... (Govt. of India) for partial financial support. The authors thank Dinesh Kumar for recording the scan- ning electron micrographs and Shivcharan Prasad and Pinakin Makwana for technical assistance. References 1 ... of rasagiline, a MAO-B inhib- itor, on the aggregation of a- synuclein, is because of its action as a free radical scavenger [36]. Thus, it may be speculated that dopamine exhib...

Ngày tải lên: 14/02/2014, 19:20

... sequencing and mutational analysis of a gene cluster involved in nitrite reduction in Paracoccus denitrificans. Antonie Leeuwenhoek 66, 111–127. 13 Kawasaki S, Arai H, Kodama T & Igarashi Y ... nitrite accumulation and consumption in Paracoccus pantotro- phus strains. Starter cultures were grown aerobically in LB with shaking before inocu- lation of mineral salt medium containing...

Ngày tải lên: 15/02/2014, 01:20

... GTATGCGATGTGGAATTTG Spcoq3-m GATGCCTTCCAATGAATTAC cyc1-w GAACCAATGAAATAAGGGCG cyc1-x GGGGATCCGTCGACCTGCAGCGTACGAGGAAAGGAAATAGGC cyc1-y GTTTAAACGAGCTCGAATTCATCGATCCGTCAACGACAGTTG cyc1-z GCATCAGAAAGCATAGGC cyc1-m ... GTACAAGCTTGTAAATTTTCGATGG Spcoq7-b CATAGAATTCTTGGTAATC Spcoq7-c AAAGTCGACATGTTGTCACGTAGACAG Spcoq7-w CAAGCAGGTGAATTAGGC Spcoq7-x GGGGATCCGTCGACCTGCAGCGTACGAAAATCGTTTACACATC Spcoq7-...

Ngày tải lên: 18/02/2014, 14:20

... Hayashi M, Inomata M, Nakamura M, Maruya M & Iwashita S (2004) Perfringolysin O, a cholesterol-binding cytolysin, as a probe for lipid rafts. Anaerobe 10, 125–134. 19 Waheed AA, Shimada Y, Heijinen ... Gomez-Mouton C, Abad JL, Mira E, Lacalle RA, Gal- lardo E, Jimenez-Baranda S, Illa I, Bernad A, Manes S & Martinez AC (2001) Segregation of leading-edge and uropod components into...

Ngày tải lên: 20/02/2014, 03:20

... ISSUES IN NATURAL LANGUAGE ACCESS TO DATABASES FROM A LOGIC PROGRAMMING PERSPECTIVE David H D Warren Artificial Intelligence Center SRI International, Menlo Park, CA 94025, USA I INTRODUCTION ... computational formalisms. The outcome of this "top-down" approach, as reallsed in the language Prolog, has a great deal in common with the relational approach to databases...

Ngày tải lên: 21/02/2014, 20:20