Báo cáo khoa học: "Cloning a new allele form of bovine TNF-α Jongsam Ahn" pdf

Báo cáo khoa học: "Cloning a new allele form of bovine TNF-α Jongsam Ahn" pdf

Báo cáo khoa học: "Cloning a new allele form of bovine TNF-α Jongsam Ahn" pdf

... analysis of bovine TNF-α revealed that a new allele form of TNF-α was cloned. The size of the PCR products was 723 bp (Fig. 1). DNA sequence analysis revealed that new allele form of TNF-α has ... TNF- α was amplified with F primer 5’-GAA GCT AGC ATG AGC ACC AAA AGC ATG ATC CGG-3’ and R primer 5’-GAA CTC GAG TCA CAG GGC GAT GAT CCC AAA GTA-5’. PCR mixture (100...

Ngày tải lên: 07/08/2014, 15:20

3 303 0
Báo cáo khoa học: GHP, a new c-type green heme protein from Halochromatium salexigens and other proteobacteria potx

Báo cáo khoa học: GHP, a new c-type green heme protein from Halochromatium salexigens and other proteobacteria potx

... of 11 kDa. Amino-acid sequence of GHP and molecular mass The complete amino-acid sequence (Fig. 2) of GHP was determined by a combination of automated Edman degradation and tandem MS of peptides ... chromosome in Ralstonia eutropha, Azoarcus sp., Methylococcus capsulatus, Bordetella pertussis, Methylobacillus flagellatus, and Burkholderia cepacia, but the RNAse, protease, and GTPas...

Ngày tải lên: 08/03/2014, 08:20

11 517 0
Báo cáo khoa học: "TOWARDS A NEW TYPE OF ANALYSE " pptx

Báo cáo khoa học: "TOWARDS A NEW TYPE OF ANALYSE " pptx

... Universfitatis C.aroli, nae: Slavica 2ra~ensia 2. ~. Z.av<~Lov~ Eva. 1~7 =. Re~ro~r~dnf :~orfe:aat~ck~' slovn~,~ ceot~n E [A retrograde morphematicd[ctiona- ry of Czech). Praha: Academia. ... project of man-machine cozununication without a pre-arranged data base (TIBAQ). The kind of morphemic analysis z~resented here is based on a retrograde (right-to-left) analys...

Ngày tải lên: 09/03/2014, 01:20

8 414 0
Tài liệu Báo cáo khoa học: Cloning, characterization and expression analysis of interleukin-10 from the common carp, Cyprinus carpio L. docx

Tài liệu Báo cáo khoa học: Cloning, characterization and expression analysis of interleukin-10 from the common carp, Cyprinus carpio L. docx

... GAGGCTAGATACTGCTCGATGT IL-10 forward3 TGATGATTTGGAACCATTATTGAA IL-10 reverse3 CACCTTTTTCCTTCATCTTTTCAT b-Actin forward1 ACTACCTCATGAAGATCCTG b-Actin reverse1 TTGCTGATCCACATCTGCTG T7- forward TAATACGACTCACTATAGGG SP6-reverse ... stimulation with concanavalin A and lipopolysaccharide. The cDNA consisted of a 1096 bp se- quence containing a 55 bp 5¢ untranslated region and a 498 bp 3¢...

Ngày tải lên: 20/02/2014, 02:21

8 584 0
Báo cáo khoa học: Phaiodotoxin, a novel structural class of insect-toxin isolated from the venom of the Mexican scorpion Anuroctonus phaiodactylus pdf

Báo cáo khoa học: Phaiodotoxin, a novel structural class of insect-toxin isolated from the venom of the Mexican scorpion Anuroctonus phaiodactylus pdf

... pectra pr oduced were analyzed manually and automatically by SEQUEST software. The acquisition and deconvolution of data were performed with the XCALI- BUR software on a Windows NT PC data system. Determination ... were obtained from data bank and the abbreviations stand for: AaH, Androctonus australis Hector; Amm, Androctonus mauretanicus mauretanicus;Bj,Buthotus judaicus;Bot,Buthus occi...

Ngày tải lên: 07/03/2014, 16:20

9 534 0
Báo cáo khoa học: "Towards a Semantic Classification of Spanish Verbs Based on Subcategorisation Information" doc

Báo cáo khoa học: "Towards a Semantic Classification of Spanish Verbs Based on Subcategorisation Information" doc

... in Data - An Introduction to Cluster Analysis. Probability and Mathematical Statistics. Jonh Wiley and Sons, Inc., New York. Anna Korhonen. 200 2a. Semantically motivated subcategorization acquisition. ... noisy fea- tures. In Proceedings of the Seventh Conference on Natural Language Learning (CoNLL-2003), page , Edmonton/Canada. Gloria V´azquez, Ana Fern´andez, Irene Castell´on, and M. A...

Ngày tải lên: 08/03/2014, 04:22

6 418 0
Báo cáo khoa học: "PENS: A Machine-aided English Writing System for Chinese Users" pdf

Báo cáo khoa học: "PENS: A Machine-aided English Writing System for Chinese Users" pdf

... Unified Approach to Statistical Language Modeling for Chinese. In IEEE, ICASPP2000. Brown,P.F.,S .A. DellaPietra,V.J.Dellapietra,and R.L.Mercer. 1993. The Mathematics of Statistical Machine Translation: ... Wu, Xuanyin Xia (1995). Large-scale automatic extraction of an English-Chinese translation lexicon. Machine Translation, 9:3-4, 285-313 (1995) Church, K.W.(1993), Char-align. Aprogramf...

Ngày tải lên: 08/03/2014, 05:20

8 396 0
Báo cáo khoa học: "Bootstrapping a Unified Model of Lexical and Phonetic Acquisition" potx

Báo cáo khoa học: "Bootstrapping a Unified Model of Lexical and Phonetic Acquisition" potx

... weights. “about” ahbawt:15, bawt:9, ihbawt:4, ahbawd:4, ih- bawd:4, ahbaat:2, baw:1, ahbaht:1, erbawd:1, bawd:1, ahbaad:1, ahpaat:1, bah:1, baht:1, ah:1, ahbahd:1, ehbaat:1, ahbaed:1, ihbaht:1, baot:1 “wanna” waanah:94, ... ihbaht:1, baot:1 “wanna” waanah:94, waanih:37, wahnah:16, waan:13, wahneh:8, wahnih:5, wahney:3, waanlih:3, wehnih:2, waaneh:2, waonih:2, waaah:1, wuhnih:1, wahn:1, waanta...

Ngày tải lên: 16/03/2014, 19:20

10 498 0
Báo cáo khoa học: "JaBot: a multilingual Java-based intelligent agent for Web sites" pdf

Báo cáo khoa học: "JaBot: a multilingual Java-based intelligent agent for Web sites" pdf

... XXI. Revista de la UNED. Read T., Bhrcena E. and Faber P. (1997) Java and its role in Natural Language Processing and Machine Translation. In Proceedings of the Machine Translation Summit ... semantic relevance in the context of Web site information retrieval, and a lexical semantic map of the particular Web site. The linguistic unit file contains a list of the grammatical...

Ngày tải lên: 17/03/2014, 07:20

5 230 0
Báo cáo khoa học: NF-jB regulates the transcription of protein tyrosine kinase Tec pdf

Báo cáo khoa học: NF-jB regulates the transcription of protein tyrosine kinase Tec pdf

... in a wide range of signaling path- ways that control mitogen-activated protein kinase (MAPK) activation, Ca 2+ influx, actin reorganization, transcriptional regulation, cell survival and cellular transformation ... were 5¢-AGTATAGATCTGTGC GGTTCCTAATTCCGACAG-3¢ (forward) and 5¢-ATGTC AAGCTTCCTTACCTGGCTGAAGCGC-3¢ (reverse). Plas- mid pcDNA1-p65 (full-length human p65 ⁄ RelA expressed from a...

Ngày tải lên: 07/03/2014, 00:20

11 451 0
w