Báo cáo vật lý: "A HYDROGEN SENSITIVE Pd/GaN SCHOTTKY DIODE SENSOR" potx

... lượng sinh vật khô và năng lượng sinh vật ướt tùy theo độ ẩm của nguyên liệu gốc. Ngoài ra chúng ta còn có một phương pháp nữa là sản xuất nhiên liệu sinh vật. * Năng lượng sinh vật khô Đốt ... này xét dạng năng lượng mà một vật có được đo nó đang chuyển động. Dạng năng lượng ấy gọi là động năng. Khi một vật có động năng thì vật đó có thể tác dụng lực lên vật khác và lực nà...

Ngày tải lên: 23/06/2013, 01:27

... 2012. c 2012 Association for Computational Linguistics A Cost Sensitive Part-of-Speech Tagging: Differentiating Serious Errors from Minor Errors Hyun-Je Song 1 Jeong-Woo Son 1 Tae-Gil Noh 2 Seong-Bae ... functions to reflect differences among POS tagging errors. The functions assign relatively small cost to minor er- rors, while larger cost is given to serious er...

Ngày tải lên: 07/03/2014, 18:20

... those problematic phenomena on which we wanted to concentrate. A Morphologically Sensitive Clustering Algorithm for Identifying Arabic Roots Anne N. DE ROECK Department of Computer Science University ... over individual query words for an Arabic information retrieval system. Journal of the American Society for Information Science. 50/6, pp 524-529. Table 8: Two-stage Al...

Ngày tải lên: 17/03/2014, 07:20

... 10C. Radioactivity in the trichloro- ATGACCATGATTACGAATTCCGAGCTCGGTACCCGGGATCCTCTAGAGTCGACCTGCAGGCATGCAAGCTT GGCACTGGCCGTCGTTTTACAACGTCGTGACTGGGAAAACCCTGGCG CAGCACTGACCCTTTTG—5’ 32p EcoR1 Sac1 Kpn1 Sma1 Xma1 BamH1 Xba1 Sal1 HincII Pst1 Sph1 HindIII LacZ Acc1 MCS M13 ... TTCGAACGTACGGACGTCCA…5’ TTCGAACGTACGGACGTCCA…5’ TTCGAACGTACGGACGTCCA…5’ 3’ GCGGTCCCAAAAGGGTCAGTGCTGCAACATTTTGCTGCCGGTCACGG...

Ngày tải lên: 30/03/2014, 08:20

... tens of thousands of instances of this pattern from the Web, to extract sets of adjectival properties for thousands of commonplace nouns. They show that if one estimates the pleasantness of ... Linguistics, pages 75–79, Jeju, Republic of Korea, 8-14 July 2012. c 2012 Association for Computational Linguistics A Context-sensitive, Multi-faceted model of Lexico-Concep...

Ngày tải lên: 30/03/2014, 17:20

... Trace Elements in Teeth: Implication for Caries 2 teeth has been suggested as being indicative of Pb toxicity. 5,9 Here, we have investigated the importance of the location of trace elements ... carious teeth than in those with healthy teeth. Keywords: ICP-MS, teeth, trace elements, caries, teeth pulps 1. INTRODUCTION Biomonitoring of trace...

Ngày tải lên: 07/08/2014, 14:20

... available in the literature. 10,11 It is reported that the ratio of the silica source to the surfactant ratio and the pH of the synthesis gel can greatly influence the characteristics of the resulting ... amounts of C1 – ions. Therefore, for the partial dehydration of PEO units, the volume of the hydrophilic part of the micelle decreases....

Ngày tải lên: 07/08/2014, 14:20

... persamaan untuk menggantikan hubungan jenis Arrhenius telah diterbitkan. Ini adalah kerana pemalar tenaga keaktifan daripada persamaan itu bukan dalam bentuk asas. Persamaan baru ini mengekalkan ... sifat asal tenaga keaktifan dan kelikatan pada suhu tidak terhingga, dan ia merangkumi pemalar baru, iaitu kelikatan pada suhu sifar. Nisbah kelikatan pada suhu sifar dan kelikatan pada suhu...

Ngày tải lên: 07/08/2014, 14:20

... A Perspective of Oil Palm and Its Waste 74 Fresh fruit bunches (FFB) Sterilisation and stripping Digestion, clarification and pressing Palm oil Empty fruit bunches (EFB) Fresh fruits Palm ... discharge of the effluents. 27 The total A Perspective of Oil Palm and Its Waste 72 providing competitive prices on oil palm, the liberalisation of expo...

Ngày tải lên: 07/08/2014, 14:20

... PREDICTION FOR MONTHLY CLEARNESS INDEX AND DAILY SOLAR RADIATION: APPLICATION FOR SIZING OF A STAND-ALONE PHOTOVOLTAIC SYSTEM A. Mellit 1,2 , A. Hadj Arab 2,3 and S. Shaari 4* 1 Department of ... thank the Director of the ONM (Office of National Meteorology of Algiers), for making available the database of solar radiation data for di...

Ngày tải lên: 07/08/2014, 14:20

... (1968). Terpenoids VII. Constituents of Euphorbia lateriflora Schum. and Thonn. Phytochemistry, 7(4), 657–660. A Chemical Study on Phyllanthus reticulatus 46 acetone-d 6 and CDCl 3 , ... 1. INTRODUCTION The Phyllanthus genus contains species which have useful medicinal applications. A considerable number of these species have been examined and some effective consti...

Ngày tải lên: 07/08/2014, 14:20

... Suharty 1* , Basuki Wirjosentono 2 , Maulidan Firdaus 1 , Desi S. Handayani 1 , Jamilatus Sholikhah 1 and Yuniarni A. Maharani 1 1 Department of Chemistry, Faculty of Mathematics and Natural ... condition. Increasing of BP concentration up to 20% in masterbatches mixture can extent the interaction among BP, AA and PP. These mean that the above mixture can arise the radical reac...

Ngày tải lên: 07/08/2014, 14:20

... increase. A Hydrogen Sensitive Pd/GaN Schottky Diode Sensor 162 capability of detecting hydrogen concentration in the part per million ranges. Additionally, the Pd-ZnO Schottky diode showed ... Growth, 273, 340–346. A Hydrogen Sensitive Pd/GaN Schottky Diode Sensor 164 REVERSE CURRENT (A) REVERSE VOLTAGE (V) Figure 2: Reverse I-V characteristics fo...

Ngày tải lên: 07/08/2014, 14:20

... the covariability between anomalous northeast monsoon (NEM) rainfall in Malaysia and the large-scale anomalous sea surface temperature (SST) in Indian Ocean, Pacific Ocean and seas surrounding ... anomaly in Malaysia and the large-scale sea surface temperature (SST) anomaly in Indian Ocean, Pacific Ocean and surrounding seas in the Maritime Co...

Ngày tải lên: 07/08/2014, 14:20

... Global Solar Radiation Estimates on a Horizontal Plane 52 Malaysia is a country that has abundant solar energy. The annual average daily solar irradiations for Malaysia have a magnitude of ... Kajian ini mendapati bahawa model Collares- Pereira dan Rabl adalah merupakan model yang terbaik. Kata kunci: model Collares-Pereira dan Rabl, sinaran solar global, mod...

Ngày tải lên: 07/08/2014, 14:20