Báo cáo toán học: "The lower tail of the random minimum spanning tree" ppsx

Báo cáo khoa học: A mutagenic analysis of the RNase mechanism of the bacterial Kid toxin by mass spectrometry pptx

Báo cáo khoa học: A mutagenic analysis of the RNase mechanism of the bacterial Kid toxin by mass spectrometry pptx

... Change GGC–GCC in A5 5 (kid A5 5G) PT69G()) TTGGCATACGTACCACAGGTGTTGTAC Change ACA–GGA in T69 (kid T69G) PT69G(+) GTACAACACCTCCGGTACGTATGCCAA Change TGA–TCC in T69 (kid T69G) Analysis of Kid RNase ... ATTGTCCGGGGTTGTTCGCAACGTACAA Change ATC–TTC in D75 (kid D75E) PD75N()) TTGTACGTTGCAATCAACCCCGGACAAT Change GAT–AAT in D75 (kid D75N) PD75N(+) ATTGTCCGGGGTTGATTGCAACGTACAA Change A...

Ngày tải lên: 16/03/2014, 03:20

14 478 0
Báo cáo khoa học: In silico analysis of the adenylation domains of the freestanding enzymes belonging to the eucaryotic nonribosomal peptide synthetase-like family pot

Báo cáo khoa học: In silico analysis of the adenylation domains of the freestanding enzymes belonging to the eucaryotic nonribosomal peptide synthetase-like family pot

... NRPS enzymes FEBS Journal 272 (2005) 929941 ê 2005 FEBS 937 In silico analysis of the adenylation domains of the freestanding enzymes belonging to the eucaryotic nonribosomal peptide synthetase-like ... the 1000 bootstrap trees; (B) maximum parsimony tree calculated with the nine amino acid lining the substrate binding pocket of adenylation do...

Ngày tải lên: 23/03/2014, 13:20

13 424 0
Báo cáo hóa học: " Validity and reliability of the Spanish version of the DN4 (Douleur Neuropathique 4 questions) questionnaire for differential diagnosis of pain syndromes associated to a neuropathic or somatic component" docx

Báo cáo hóa học: " Validity and reliability of the Spanish version of the DN4 (Douleur Neuropathique 4 questions) questionnaire for differential diagnosis of pain syndromes associated to a neuropathic or somatic component" docx

... properties of validity for differential diagnosis of neuropathic pain vs non -neuropathic pain for a cut-off value ≥ 4 points in the Spanish version of the DN4 questionnaire, in the overall sample and ... for the diagnosis of neuropathic pain is a total score of 4/ 10. All questions are related to pain which is the claim for c...

Ngày tải lên: 18/06/2014, 22:20

10 532 0
báo cáo hóa học: " Development and validation of the Brazilian version of the Attitudes to Aging Questionnaire (AAQ): An example of merging classical psychometric theory and the Rasch measurement model" pptx

báo cáo hóa học: " Development and validation of the Brazilian version of the Attitudes to Aging Questionnaire (AAQ): An example of merging classical psychometric theory and the Rasch measurement model" pptx

... Central Page 1 of 10 (page number not for citation purposes) Health and Quality of Life Outcomes Open Access Research Development and validation of the Brazilian version of the Attitudes to Aging Questionnaire ... values analysis, item and subscales correlations and internal reliability analyses. Exploratory and Con- firmatory Factor analysis were perform...

Ngày tải lên: 18/06/2014, 22:20

10 871 0
Báo cáo hóa học: " Some psychometric properties of the Chinese version of the Modified Dental Anxiety Scale with cross validation" pptx

Báo cáo hóa học: " Some psychometric properties of the Chinese version of the Modified Dental Anxiety Scale with cross validation" pptx

... 1 of 11 (page number not for citation purposes) Health and Quality of Life Outcomes Open Access Research Some psychometric properties of the Chinese version of the Modified Dental Anxiety Scale ... assess the factorial structure and construct validity for the Chi- nese version of the Modified Dental Anxiety Scale (MDAS). The specific objective...

Ngày tải lên: 18/06/2014, 22:20

11 457 0
báo cáo hóa học: " Reliability and validity of the Spanish version of the 10-item Connor-Davidson Resilience Scale (10-item CD-RISC) in young adults" potx

báo cáo hóa học: " Reliability and validity of the Spanish version of the 10-item Connor-Davidson Resilience Scale (10-item CD-RISC) in young adults" potx

... level of reliability and validity in young adults. The findings also con- firmed a single dimension underlying the 10 items of the scale. The reliability of the Spanish version of the 10-item CD-RISC ... properties in its original version in English. The aim of this study was to evaluate the validity and reliability of the Spanish...

Ngày tải lên: 20/06/2014, 15:20

6 406 0
báo cáo hóa học:" Validity and reliability of the Iranian version of the Pediatric Quality of Life InventoryTM 4.0 (PedsQLTM) Generic Core Scales in children" ppt

báo cáo hóa học:" Validity and reliability of the Iranian version of the Pediatric Quality of Life InventoryTM 4.0 (PedsQLTM) Generic Core Scales in children" ppt

... available soon. Validity and reliability of the Iranian version of the Pediatric Quality of Life InventoryTM 4.0 (PedsQLTM) Generic Core Scales in children Health and Quality of Life Outcomes 2012, ... properties of the Greek version of the Pediatric Quality of Life Inventory(TM) 4.0 Generic Core Scales. Quality of...

Ngày tải lên: 20/06/2014, 15:20

27 429 0
báo cáo hóa học:" Validity and reliability of the Spanish version of the DN4 (Douleur Neuropathique 4 questions) questionnaire for differential diagnosis of pain syndromes associated to a neuropathic or somatic component" pdf

báo cáo hóa học:" Validity and reliability of the Spanish version of the DN4 (Douleur Neuropathique 4 questions) questionnaire for differential diagnosis of pain syndromes associated to a neuropathic or somatic component" pdf

... score of 0 to each negative item. The total score is calculated as the sum of all 10 items, and the cut-off value for the diagnosis of neuropathic pain is a total score of 4/ 10. All questions are ... measurements and statistical analysis Reliability The internal consistency of the Spanish version of the DN4 questionnaire was separately est...

Ngày tải lên: 20/06/2014, 16:20

10 489 0
báo cáo hóa học:" Development and validation of the Brazilian version of the Attitudes to Aging Questionnaire (AAQ): An example of merging classical psychometric theory and the Rasch measurement model" docx

báo cáo hóa học:" Development and validation of the Brazilian version of the Attitudes to Aging Questionnaire (AAQ): An example of merging classical psychometric theory and the Rasch measurement model" docx

... Access Research Development and validation of the Brazilian version of the Attitudes to Aging Questionnaire (AAQ): An example of merging classical psychometric theory and the Rasch measurement model Eduardo Chachamovich* 1,2 , ... thresh- olds and differential item functioning. The present paper aims to illustrate the potential combi...

Ngày tải lên: 20/06/2014, 16:20

10 737 0
báo cáo hóa học:" Reliability and validity of the Spanish version of the Child Health and Illness Profile (CHIP) ChildEdition, Parent Report Form (CHIP-CE/PRF)" pot

báo cáo hóa học:" Reliability and validity of the Spanish version of the Child Health and Illness Profile (CHIP) ChildEdition, Parent Report Form (CHIP-CE/PRF)" pot

... Starfield B: Reliability and Validity of the Spanish version of the Child Health and Illness Profile (CHIP) Child- Edition, Child Report Form (CHIP-CE/CRF), submitted). Methods Sample selection and procedures Parents ... [13]. The aims of the present study were to assess the relia- bility, and content and construct validity of the Sp...

Ngày tải lên: 20/06/2014, 16:20

9 381 0
Báo cáo toán học: "A Combinatorial Proof of the Log-concavity of a famous sequence counting permutations" potx

Báo cáo toán học: "A Combinatorial Proof of the Log-concavity of a famous sequence counting permutations" potx

... Subject Classifications: 0 5A0 5, 0 5A1 5 To Richard Stanley, who introduced me to the area of log-concave sequences. Abstract We provide a combinatorial proof for the fact that for any fixed n, the sequence {i(n, ... A Combinatorial Proof of the Log-concavity of a famous sequence counting permutations Mikl´os B´ona ∗ Submitted: Nov 24, 2004; Accepted: Jan...

Ngày tải lên: 07/08/2014, 08:22

4 227 0
Báo cáo toán học: "Convexly independent subsets of the Minkowski sum of planar point sets" pdf

Báo cáo toán học: "Convexly independent subsets of the Minkowski sum of planar point sets" pdf

... and Q be finite sets of points in the plane. In this note we consider the largest cardinality of a subset of the Minkowski sum S ⊆ P ⊕ Q which consist of convexly independent points. We show that, ... X of n points in the plane, what is the maximum number of pairs that can be selected from X so that the midpoints of their connecting segments are convexly indepe...

Ngày tải lên: 07/08/2014, 15:23

4 206 0
Báo cáo toán học: "Sharp lower bound for the total number of matchings of tricyclic graphs" doc

Báo cáo toán học: "Sharp lower bound for the total number of matchings of tricyclic graphs" doc

... T n be the class of tricyclic graphs on n vertices. In this paper, a sharp lower bound for the total number of matchings of graphs in T n is determined. 1 Introduction The total number of matchings ... index of hexagonal spiders. In light of the information available for the total number of matchings of trees, unicyclic graphs, bicyclic gr...

Ngày tải lên: 08/08/2014, 12:22

15 359 0
Báo cáo toán học: "A new bound on the domination number of graphs with minimum degree two" docx

Báo cáo toán học: "A new bound on the domination number of graphs with minimum degree two" docx

... X u )-DS of G. Hence, γ(G u ; X u ) ≤ |D v | + 1 = γ(G v ; X v ) + 1. ✷ the electronic journal of combinatorics 18 (2011), #P12 34 A new bound on the domination number of graphs with minimum degree ... is of interest to determine upper bounds on the domination number of a graph. In 1989, McCuaig and Shepherd [12] presented the beautiful result that...

Ngày tải lên: 08/08/2014, 12:23

35 259 0
w