Báo cáo toán học: "The subword complexity of a two-parameter family of sequences" pps
... ∈ >0 . In this paper we investigate an additional property of the class of heap games for general s, t ∈ >0 : the subword complexity of the characteristic function of A. Forfixed s, t ∈ >0 , ... question of whether A has a similar property when s ≥ 2. Perhaps associated with some of the A sequences for s ≥ 2 is an integer m ≥ 2 such that for all i, j, k, | (A k...
Ngày tải lên: 07/08/2014, 06:23
... recoverable using any algorithm designed to compute the product of an adjacency matrix of the graph and an arbitrary vector. The linear complexity of a graph may therefore be seen as a measure of ... linear complexity of any one of the graph’s adjacency matrices. If A is any matrix, then the linear complexity of A is essentially the minimum number of additions, s...
Ngày tải lên: 07/08/2014, 13:21
... [9], Australia [14] and Canada [7]. Generally male pharma- cists predominated above the age of 50. Education One response to the shortage of pharmacists was found to be a planned expansion of the ... Responses to National Survey of Pharmacists (Owners and Managers) 2007 [http://www.pharmacyhr.ca/ ResearchAndReports.aspx]. 29. Blackburn J: An Environmental Scan of Pharmacy Technici...
Ngày tải lên: 18/06/2014, 17:20
Báo cáo toán học: " Could petroleum biodegradation be a joint achievement of aerobic and anaerobic microrganisms in deep sea reservoirs?" pptx
... indicating the existence of alternating aerobic and anaerobic lifecycles. A comparative biodegradation of terpanes, hopanes and steranes under aerobic and anaerobic conditions, Table 3, indicate ... Lira-Galeana, C. & Mesta-Howard, A. M. (2004) A microbial consortium isolated from a crude oil sample that uses asphaltenes as a carbon and energy source. Biodegradation 15, 1...
Ngày tải lên: 20/06/2014, 21:20
Báo cáo toán học: "VEGF T-1498C polymorphism, a predictive marker of differentiation of colorectal adenocarcinomas in Japanese" docx
... T -1498 -allele probe VIC-CTCCAACaCCCTCAAC C -1498 -allele probe FAM-CCAACgCCCTCAAC C-7T Forward primer CCGAGCCGGAGAGGGA Reverse primer GCACCCAAGACAGCAGAAAGT C -7 -allele probe VIC-CATGGTTTCgGAGGCC ... Kuwahara 1 , Koichi Iwaki 1 , Takao Tamura 4 , Nobuo Aoyama 5 , Svetlana Markova 2 , Masato Kasuga 4 , Katsuhiko Okumura 1, 2, 3 , Toshiyuki Sakaeda 2, 6 1. Department of Hos...
Ngày tải lên: 08/08/2014, 17:20
Báo cáo y học: "The P2X7 receptor is a candidate product of murine and human lupus susceptibility loci: a hypothesis and comparison of murine allelic products" potx
... belongs to a category that bears many of the hall- marks of 'classic' caspase-dependent apoptosis, but also to other categories such as cytoplasmic vacuolization more often associated with ... L, Papucci L, Tani A, Schiavone N, Tempestini A, Orlandini GE, Capaccioli S, Orlandini SZ: Aponecrosis: morphological and biochemical exploration of a syncretic process of cell d...
Ngày tải lên: 09/08/2014, 06:22
Báo cáo toán học: "The complexity of constructing gerechte designs" potx
... be a bipartite graph. Then the chromatic index of G is equal to the maximum vertex degree of G. We define a partial latin square of order n to be an n × n array, containing some empty cells and ... the array, at each stage trying all the symbols from {1, . . . , n} until the oracle says that the partial filling has a completion. Note that if the first call to the oracle gives a neg...
Ngày tải lên: 07/08/2014, 21:21
Báo cáo toán học: "the complexity of obtaining a distance-balanced graph" pptx
... the area of facility location problems [4] because the median of a graph comprises of vertices that have a minimal sum of distances to all other vertices. They are also useful in mathematical ... combinatorics 18 (2011), #P49 2 The complexity of obtaining a distance-balanced graph Sergio Cabello ∗ Faculty of Mathematics and Physics , University of Ljubljana, and Institut...
Ngày tải lên: 08/08/2014, 12:23
Báo cáo khoa học: "THE COMPUTATIONAL COMPLEXITY OF AVOIDING CONVERSATIONAL IMPLICATURES" pdf
... incorporated into a polyno- mial time generation algorithm, while some alterna- tive formalizations of conversational impficature make the generation task NP-Hard. 1. Introduction Natural language ... model that covered situations where the hearer was not already aware of the referred-to object, and that al- lowed the speaker to have more complex communicative goals. A similar...
Ngày tải lên: 17/03/2014, 20:20
Báo cáo toán học: " The structural and optical properties of GaSb/InGaAs type- quantum dots grown on InP (100) substrate" ppt
... GaSb/In 0.53 Ga 0.47 As QDs and histogram of the height of GaSb/In 0.53 Ga 0.47 As QDs. (a) The AFM image of GaSb/In 0.53 Ga 0.47 As QDs, (b) histogram of the height of GaSb/In 0.53 Ga 0.47 As QDs, and ... quantum-size nanostructures composed of III and V direct-bandgap semiconductor materials, such as GaSb/GaAs [8-10], InAlAs/InP [11], InP/InGaP [12, 13], InP/GaAs [14], GaAs...
Ngày tải lên: 20/06/2014, 20:20