... manuscript, and participated in the acquisi- tion of data. AZ participated in the coordination of the study. AAZ participated in the design of the study, and performed the statistical analysis. RA conceived ... production was enhanced by IL-4 and IL-5, and suggests a T-helper lymphocyte type 2 cytokine activation in response to sepsis after traumatic injury. Eosinophils normally a...
Ngày tải lên: 25/10/2012, 10:35
... by unleashing NMDA and AMPA excitotoxic injury. Thus a mecha- nism by which abnormal energy metabolism may have an influence on clinical ALS is through depletion of Vgf neuroprotection against ... Acad Sci USA 2006; 103(39): 14584-14589. 16. Yamaguchi H, Sasaki K, Satomi Y, Shimbara T, Kageyama H, Mondal MS, Toshinai K, Date Y, Gonzalez LJ, Shioda S, Takao T, Nakazato M, Minamin...
Ngày tải lên: 03/11/2012, 10:52
Tài liệu Báo cáo khoa học: NirF is a periplasmic protein that binds d1 heme as part of its essential role in d1 heme biogenesis pdf
... similar to that in Asp141 of Met8P. The idea of NirF being a dehydrogenase is appealing because of the presence of a putative nucleotide-bind- ing motif in the N-terminal of the protein sequence and ... to seek accu- mulation of the substrate of NirF in a mutant that lacks NirF; this too is not trivial as the DnirF strain does not accumulate readily...
Ngày tải lên: 15/02/2014, 01:20
Báo cáo khoa học: Interaction of the general transcription factor TnrA with the PII-like protein GlnK and glutamine synthetase in Bacillus subtilis potx
... in uence the GlnK TnrA interaction, either alone, in the absence of divalent metals, or in combination with ATP and Mg 2+ or Mn 2+ . To resolve the inhibitory effect of ATP on the GlnK TnrA interaction ... affect the binding of ATP to GlnK [12]. Therefore, we investigated the binding of TnrA to GlnK in the presence of different mixtures of Mg...
Ngày tải lên: 06/03/2014, 00:21
Báo cáo khoa học: Lpx1p is a peroxisomal lipase required for normal peroxisome morphology potx
... preparations in triplicate. Candida rugosa lipase (CRL) was used as a positive control for lipase measurement. (Pancreas) lipase activity assays used DGR in a coupled enzyme assay as a sub- strate. ... Woolford CA, Noble JA, Garman JD, Tam MF, Innis MA & Jones EW (1993) Phenotypic analysis of protein- ase A mutants. Implications for autoactivation and the maturation path...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo sinh học: " Repressor element-1 silencing transcription factor/neuronal restrictive silencer factor (REST/NRSF) can regulate HSV-1 immediate-early transcription via histone modification" pptx
... Journal Open Access Research Repressor element-1 silencing transcription factor/ neuronal restrictive silencer factor (REST/NRSF) can regulate HSV-1 immediate-early transcription via histone modification Rajeswara ... (RE-1/NRSE) located between HSV-1 genes ICP22 and ICP4. We predicted that the Repressor Element Silencing Transcription Factor/ Neur...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo sinh học: "Aurora Kinase A expression is associated with lung cancer histological-subtypes and with tumor de-differentiation" doc
... follows: AURKA.FW: GAGATTTTGGGTGGTCAGTAGATG, AURKA.RW: TAGTCCAGCGTGCCACAGAGA, ESD.FW:TGTTGTC ATTGCTCCAGATACCA, ESD.RW:CCCAGCTCTCAT CTTCACCTTT, POLR2B.FW:CCTGATCATAACCAG TCCCCTAGA,OLR2B.RW:GTAAACTCCCATAGCCT GCTTACC. Melting ... 9:100 http://www.translational-medicine.com/content/9/1/100 Page 2 of 6 RESEARCH Open Access Aurora Kinase A expression is associated with lung cancer...
Ngày tải lên: 18/06/2014, 19:20
Báo cáo sinh học: " Development of a real-time QPCR assay for the detection of RV2 lineage-specific rhadinoviruses in macaques and baboons" docx
... positive macaques, the RV-2 assay result was low and outside the linear range of the assay. Discussion We have developed a TaqMan probe-based QPCR assay to quantitate the viral load of macaque rhadinoviruses belonging ... assay. The RV-2 QPCR assay was negative for these templates under the standard reaction conditions. Identification of a novel RV2...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo sinh học: " Chloroquine is a potent inhibitor of SARS coronavirus infection and spread" pptx
... and FACS analysis. BE performed data acquisition from the immunofluorescence experiments. PR and TK provided critical reagents and revised the manuscript critically. NS and SN along with MV and ... WJ, Farzan M, Marasco WA: Potent neutralization of severe acute respira- tory syndrome (SARS) coronavirus by a human mAb to S1 protein that blocks receptor association. Proc Natl...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học:" Chloroquine is a potent inhibitor of SARS coronavirus infection and spread" docx
... Seidah 2 and Stuart T Nichol* 1 Address: 1 Special Pathogens Brach, Division of Viral and Rickettsial Diseases, Centers for Disease Control and Prevention, 1600 Clifton Road, Atlanta, Georgia, ... with MV and EB participated in the plan- ning of the experiments, review and interpretation of data and critical review of the manuscript. All authors read and approved the...
Ngày tải lên: 20/06/2014, 04:20
Báo cáo hóa học: " Research Article A Sociability-Based Routing Scheme for Delay-Tolerant Networks" doc
... extra nodes whose paths are optimized based on a delay constraint. In [14], cars act as data mules and employ a carry-and-forward paradigm to transfer data packets to a portal. Finally, in [15], opportunistic ... delay-tolerant applications. A variety of measurements have been made recently available on the Internet [3, 26] in the form of traffic traces or contact patterns. When a h...
Ngày tải lên: 21/06/2014, 11:20
Báo cáo sinh học: " Research Article A Baseband Signal Processing Scheme for Joint Data Frame Synchronization and Symbol Decoding for RFID Systems" docx
... Viterbi algorithm is extended to a group of two substates, including a dilated and a shrunk substate, each of which corresponds to a variant FM0 baseband signal. These variant FM0 baseband signals are ... 5, and then the transmitted waveform is the product of these baseband data symbols and a square wave at M times the symbol rate. The value M is specified in the Que...
Ngày tải lên: 21/06/2014, 16:20
Báo cáo sinh học: "Imp-L2, a putative homolog of vertebrate IGF-binding protein 7, counteracts insulin signaling in Drosophila and is essential for starvation resistance" ppt
... functional characterization of an insulin- binding protein in invertebrates. We have identified Imp-L2 as a secreted antagonist of IIS in Drosophila. Given the sequence homology of their Ig domains, ... genetic analyses of IIS in Drosophila and Caenorhabditis elegans have not revealed a functional insulin- binding protein so far. Here, we report the identification...
Ngày tải lên: 06/08/2014, 18:21
Báo cáo sinh học: "TBP2 is a general transcription factor specialized for female germ cells" doc
... ovary in anamniotes [4,7]. Minireview TBP2 is a general transcription factor specialized for female germ cells Ferenc Müller* and Làszlò Tora † Addresses: *Department of Medical and Molecular ... initiation of transcription by RNA poly- merase II (Pol II) is central to any developmental process. A key regulatory step in eukaryotic transcription initiation is the...
Ngày tải lên: 06/08/2014, 19:21
báo cáo khoa học: " Identification of a GCC transcription factor responding to fruit colour change events in citrus through the transcriptomic analyses of two mutants" potx
... gggaagcaggtgaagatgatgttagagaagcaattaaaatcaaaccagaaataa tttgag G K Q V K M M L E K Q L K S N Q K 721 ctttacgattataattatgtcgacagagatggtgttagaaaaggattaattgtagtttat 781 tgacaacataatcacaagaaaaacaaaaatgattgtagtaataatttaatttttttcttt 841 ... tgacaacataatcacaagaaaaacaaaaatgattgtagtaataatttaatttttttcttt 841 ccccaacaaaacctcaatgatacaaaagaattttaataaaaaaaaaaaaaaaaaaaaaaa Figure 3 Full-length cDNA and dedu...
Ngày tải lên: 11/08/2014, 11:21