Báo cáo sinh học : "Q&A: Epistasis" pot

báo cáo sinh học:" Developing a competency-based curriculum in HIV for nursing schools in Haiti" pdf

báo cáo sinh học:" Developing a competency-based curriculum in HIV for nursing schools in Haiti" pdf

... Training and Education Center on HIV (I-TECH): Needs assessment of Haiti nursing schools. Port-au-Prince 2006. 9. National Postsecondary Education Cooperative: Defining and assessing learning: ... [1]. Task shifting has lead nurses to be heavily involved in per- forming HIV testing and counselling, assessing patients for ART eligibility, assessing toxicity and treatment failure, an...

Ngày tải lên: 18/06/2014, 17:20

7 377 0
báo cáo sinh học:" Developing a tool to measure health worker motivation in district hospitals in Kenya" pot

báo cáo sinh học:" Developing a tool to measure health worker motivation in district hospitals in Kenya" pot

... practices in eight district hospitals in Kenya. In the absence of available tools, we therefore aimed to develop a tool that could enable a rapid measurement of motivation at baseline and at ... Kenyan district hospitals. From this starting point, we have been able to develop a potentially rapid motivation measurement tool aimed at exploring motivation as a...

Ngày tải lên: 18/06/2014, 17:20

11 446 0
Báo cáo sinh học: " Motavizumab, A Neutralizing Anti-Respiratory Syncytial Virus (Rsv) Monoclonal Antibody Significantly Modifies The Local And Systemic Cytokine Responses Induced By Rsv In The Mouse Model" pdf

Báo cáo sinh học: " Motavizumab, A Neutralizing Anti-Respiratory Syncytial Virus (Rsv) Monoclonal Antibody Significantly Modifies The Local And Systemic Cytokine Responses Induced By Rsv In The Mouse Model" pdf

... took an alternative approach to explore the relative importance and role that different cytokines and chemokines play in acute RSV disease sever- ity. Instead of targeting individual cytokines as ... before virus inoculation. Bronchoalveolar lavage (BAL) and serum samples were obtained at days 1, 5 (acute) and 28 (long-term) post inoculation and analyzed with a multiplex a...

Ngày tải lên: 18/06/2014, 18:20

5 357 0
Báo cáo sinh học: "Enabling a robust scalable manufacturing process for therapeutic exosomes through oncogenic " ppt

Báo cáo sinh học: "Enabling a robust scalable manufacturing process for therapeutic exosomes through oncogenic " ppt

... stem and endothelial progenitor cells in acute renal injury: ca ira. Curr Opin Pharmacol 2006, 6(2):176-183. 12. Miyahara Y, Nagaya N, Kataoka M, Yanagawa B, Tanaka K, Hao H, Ishino K, Ishida H, ... tera- toma formation. MSC tra nsplantation has been used in clinical trials and animal models to treat musculoskeletal injuries, improve cardiac function in cardiovascular dis eas e and ameliorate...

Ngày tải lên: 18/06/2014, 19:20

10 343 0
Báo cáo sinh học: "Immunological abnormalities as potential biomarkers in Chronic Fatigue Syndrome/Myalgic Encephalomyelitis" ppt

Báo cáo sinh học: "Immunological abnormalities as potential biomarkers in Chronic Fatigue Syndrome/Myalgic Encephalomyelitis" ppt

... populations has not been fully studied in CFS/ME. Importantly, recent data on cytokine distribution in CFS/ME patients point towardsanincreaseinpro-inf lammatory cytokine s suggesting the presence ... flu-like symptoms. An increase in IL-10 also may contribute to decreased cytotoxic activity observed in the NK and CD8 + T cells [39,40]. The increase in pro-inflammatory cytokines suc...

Ngày tải lên: 18/06/2014, 19:20

9 380 0
Báo cáo sinh học: " Periostin: a promising target of therapeutical intervention for prostate cancer" potx

Báo cáo sinh học: " Periostin: a promising target of therapeutical intervention for prostate cancer" potx

... as follows: Periostin (forward, 5’ AGGCAAACAG CTCAGAGTCTTCGT 3’ and reverse, 5’ TGCAGCTTCAAGTAGGCTGAGGAA 3’ ). b-actin (forward, 5’ CTGGCACCACACCTTCTA- CAATGA 3’ and reverse, 5’ TTAATGTCACGCAC- GATTTCCCGC ... 9:99 http://www.translational-medicine.com/content/9/1/99 Page 8 of 10 hyperplasia; HE: hematoxylin and eosin; iTRAQ: isobaric tags for relative and absolute quantification; PAP: pr...

Ngày tải lên: 18/06/2014, 19:20

10 362 0
Báo cáo sinh học: "Developing a theoretical relationship between electrical resistivity, temperature, and film thickness for conductors" pptx

Báo cáo sinh học: "Developing a theoretical relationship between electrical resistivity, temperature, and film thickness for conductors" pptx

... to make it more adaptive and capable of producing data that are compatible with the experimental results. If the film has a thickness larger than two times the mean free path and a measured ... resistivities for various metals as a function of film thickness. The materials in these graphs are (a) aluminum, (b) copper, and (c) gold (the experimental data is adapted...

Ngày tải lên: 18/06/2014, 22:20

26 376 0
Báo cáo sinh học: " Q&A: What did Charles Darwin prove" ppsx

Báo cáo sinh học: " Q&A: What did Charles Darwin prove" ppsx

... explanations for the results. Darwin was one of those. For exam- ple, it had been claimed that orchids did not secrete nectar but that they fooled insects into believing they did; the conspicuous nectaries ... have made a big deal of developing and applying new statistical methods, but Darwin was on to the problem. He just did not use statistics and probabilities, which is why I cal...

Ngày tải lên: 06/08/2014, 18:21

3 279 0
Báo cáo sinh học : "Q&A: Genetic analysis of quantitative traits" pdf

Báo cáo sinh học : "Q&A: Genetic analysis of quantitative traits" pdf

... to Quantitative Genetics , 4 th edition. Harlow, Essex: Longman; 1996. Lynch M, Walsh B: Genetics and Analysis of Quantitative Traits . Sunderland, MA: Sinauer; 1998. Published: 17 April 2009 Journal of ... environments. These resources offer the prospect of elucidating the genetics of the interdependence of multiple phenotypes, and addressing the longstanding question of t...

Ngày tải lên: 06/08/2014, 19:20

5 361 0
Báo cáo sinh học : "Q&A: Epistasis" pot

Báo cáo sinh học : "Q&A: Epistasis" pot

... Edinb 1918, 552 2:: 399-433. 3. Guarente L: SSyynntthheettiicc eennhhaanncceemmeenntt iinn ggeennee iinntteerraaccttiioonn :: aa ggeenneettiicc ttooooll ccoommee ooff aaggee Trends Genet 1993, 110 0:: 362-366. 4. ... Wasserman S: OOrrddeerriinngg ggeennee ffuunnccttiioonn :: tthhee iinntteerrpprreettaattiioonn ooff eeppiissttaassiiss iinn rreegguullaattoorryy hhiieerraarrcchhiiees...

Ngày tải lên: 06/08/2014, 19:20

5 361 0
Báo cáo sinh học: "Q&A: What are pharmacological chaperones and why are they interesting" pdf

Báo cáo sinh học: "Q&A: What are pharmacological chaperones and why are they interesting" pdf

... such as glycerol and trehalose. Pharmacological chaperones are a special subset of chemical chaperones. Molecules like glycerol and trehalose are nonspecific: they bind to, and stabilize, practically ... levels below what is required to maintain the health of the cell. Also, it is possible that the Question & Answer Q&A: What are pharmacological chapero...

Ngày tải lên: 06/08/2014, 19:21

4 275 0
Báo cáo sinh học: "Q&A: Quantitative approaches to planar polarity and tissue organization" pot

Báo cáo sinh học: "Q&A: Quantitative approaches to planar polarity and tissue organization" pot

... molecular and mechanical demands on the tissue? Another open question is how the core PCP proteins are able to mediate the wide range of cell behaviors associated with planar polarity. Planar polarity ... display two types of polarity: apical-basal polarity and planar cell polarity (PCP; also called tissue polarity) . Apical-basal polarity refers to the asymme...

Ngày tải lên: 06/08/2014, 19:21

5 384 0
Báo cáo sinh học: "Q&A: What can microfluidics do for stem-cell research" ppsx

Báo cáo sinh học: "Q&A: What can microfluidics do for stem-cell research" ppsx

... Biology 2010, 9:1 http://jbiol.com/content/9/1/1 doi:10.1186/jbiol220 Cite this article as: Csete M: Q&A: What can microfluidics do for stem-cell research? Journal of Biology 2010, 9:1. Page ... of the microenvironment, and information from experi- ments can be fed back into mathematical models to determine optimal design features to promote specific stem-cell behaviors. G...

Ngày tải lên: 06/08/2014, 19:21

3 294 0
Báo cáo sinh học: "CHSMiner: a GUI tool to identify chromosomal homologous segments" pot

Báo cáo sinh học: "CHSMiner: a GUI tool to identify chromosomal homologous segments" pot

... the maximal gap size (number of unmatched genes) allowed between two adjacent matched genes (Figure 1). Another advantage of the algorithm is that the greedy search has a fast computa- tional speed ... ena- bles it to discover highly degenerated homology. Compared with previous tools, it has at least three signif- icant advantages: (1) it has comprised search algorithm, statistical valida...

Ngày tải lên: 12/08/2014, 17:20

7 271 0
Báo cáo sinh học: "ChickRH6: a chicken whole-genome radiation hybrid panel" pot

Báo cáo sinh học: "ChickRH6: a chicken whole-genome radiation hybrid panel" pot

... Jr., Ono T., Hayashi H., Takagi T., Nakamura Y., Tanigami A. , Goodfellow P.N., Lathrop G.M., James M.R., A whole-genome radiation hybrid panel and framework map of the rat genome, Mamm. Genome ... agronomique, 31326 Castanet-Tolosan, France (Received 4 February 2002; accepted 13 May 2002) Abstract – As a first step towards the development of radiation hybrid maps, we have produ...

Ngày tải lên: 14/08/2014, 13:21

13 142 0
w