Báo cáo sinh học : "Reconstructing prokaryotic transcriptional regulatory networks: lessons from actinobacteria" ppt
Báo cáo sinh học : "Reconstructing prokaryotic transcriptional regulatory networks: lessons from actinobacteria" ppt
... 2009, 8 8:: 29 Published: 15 April 2009 Journal of Biology 2009, 8 8:: 29 (doi:10.1186/jbiol132) The electronic version of this article is the complete one and can be found online at http://jbiol.com/content/8/3/29 © ... 2007, 8 8:: 293. http://jbiol.com/content/8/3/29 Journal of Biology 2009, Volume 8, Article 29 Venancio and Aravind 29.5 Journal of Biology 2009, 8 8:: 29...
Ngày tải lên: 06/08/2014, 19:20
Báo cáo sinh học : "Parental squabbles and genome expression: lessons from the polyploids" ppsx
... insights into regulatory events that have affected the evolution of allopolyploid cotton. Journal of Biology 2009, 8 8:: 43 Published: 1 May 2009 Journal of Biology 2009, 8 8:: 43 (doi:10.1186/jbiol140) The ... tthhaalliiaannaa Science 2009, 33223 3:: 623-626. 9. Preuss S, Pikaard CS: rrRRNNAA ggeennee ssiilleenncciinngg aanndd nnuucclleeoollaarr ddoommii nnaannccee :: ii...
Ngày tải lên: 06/08/2014, 19:20
Báo cáo sinh học: " In vivo transcriptional targeting into the retinal vasculature using recombinant baculovirus carrying the human flt-1 promoter" potx
... for transcriptional targeted gene expression into the eye vasculature. Published: 18 September 2007 Virology Journal 2007, 4:8 8 doi:10.1186/1743-422X-4-88 Received: 21 June 2007 Accepted: 18 ... 90(1 ):3 9-44. 31. Blann AD: Plasma von Willebrand factor, thrombosis, and the endothelium: the first 30 years. Thromb Haemost 2006, 95(1 ):4 9-55. 32. Wang CY, Li F, Yang Y, Guo HY, Wu CX, W...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo sinh học: "Identification of conserved regulatory elements by comparative genome analysis" docx
... Kel-Margoulis OV, et al .: TRANS- FAC: transcriptional regulation, from patterns to profiles. Nucleic Acids Res 2003, 3 1:3 74-378. 21. TRANSFAC - The Transcription Factor Database [http://transfac.gbf.de/TRANSFAC/] 22. ... 1994, 2 2:4 673-4680. 26. Schneider TD, Stephens RM: Sequence logos: a new way to display consensus sequences. Nucleic Acids Res 1990, 1 8:6 097- 6100. 27. Le...
Ngày tải lên: 06/08/2014, 18:20
Báo cáo sinh học: " Systematic identification of regulatory proteins critical for T -cell activation" doc
... AM: RING finger proteins: mediators of ubiquitin ligase activity. Cell 2000, 10 2:5 49-552. 29. Ben-Neriah Y: Regulatory functions of ubiquitination in the immune system. Nat Immunol 2002, 3:2 0-26. 30. ... GPIa ): homology to other integrins and the presence of a possi- ble collagen-binding domain. J Cell Biol 1989, 10 9:3 97-407. 74. Kolanus W, Seed B: Integrins and inside-out s...
Ngày tải lên: 06/08/2014, 18:20
báo cáo khoa học: " Prediction of transcriptional regulatory elements for plant hormone responses based on microarray data" docx
... Drt5 ACACGCGTAGAGAGCAAAATGACTTTGACGTCACACCACGAAAACAGACGCTTCATACGTGTCCCTTTATCTCTCTCAGTCTCTCTATAAACTTAGTGAGACCCTCCTCTGTTTTACTCACAAAT ACACGCGTAG: Drought TACGTGTCCC: Drought ATACGTGTCCC: ABA ACACGCGT: AtREG536 TACGTGTC: AtREG557 TCTCTATA: AtTATA323 peak TSS: A ACGTGTCC: AtREG472 CTCTATAA: AtTATA280 TACGTGTC: ABRE TCTATAAA: AtTATA245 A B ... TTAGGATGGAATAAATATCATACCGACATCAGTTTGAAA...
Ngày tải lên: 11/08/2014, 11:21
Báo cáo khoa học: "Reconstructing false start errors in spontaneous speech text" ppt
... as shown below. corr(c) = i:c w i =c δ(c w i = c g 1 ,i or c w i = c g 2 ,i ) false(c) = i:c w i =c δ(c w i = c g 1 ,i and c w i = c g 2 ,i ) miss(c) = i:c g 1 ,i =c δ(c w i = c g 1 ,i ) where ... 47.0% Table 6: Word-level error predictions: exact SU match results. JC04-2 was run only on test sentences known to contain some error to match the conditions of Setup #3 and #5 (from T...
Ngày tải lên: 08/03/2014, 21:20
báo cáo sinh học:" Nurses'''' experiences of recruitment and migration from developing countries: a phenomenological approach" pdf
... coun- Published: 7 June 2007 Human Resources for Health 2007, 5:1 5 doi:10.1186/1478-4491-5-15 Received: 29 January 2007 Accepted: 7 June 2007 This article is available from: http://www.human-resources-health.com/content/5/1/15 © ... Dublin , Accessed: 23 Jan 2007 22. Rose K: Unstructured and semi-structured interviewing. Nurse Researcher 1994, 1(3 ):2 3-32. 23. Coffey A, Atkinson P: Mak...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" Conflict among Iranian hospital nurses: a qualitative study" ppt
... [6]. Published: 20 March 2009 Human Resources for Health 2009, 7:2 5 doi:10.1186/1478-4491-7-25 Received: 4 November 2008 Accepted: 20 March 2009 This article is available from: http://www.human-resources-health.com/content/7/1/25 © ... 1 8:1 71-180. 15. Valentine PE: Management of conflict: do nurses/women han- dle it differently? J Adv Nurs 1995, 2 2:1 42-149. 16. Eason FR, Brown ST:...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" Profiling alumni of a Brazilian public dental school" ppt
... Goias. Received: 31 July 2009 Accepted: 18 August 2010 Published: 18 August 2010 References 1. Bravo-Perez M: Inequalities in the workload per dentist in Spain from 1987 to 199 7: Workload per ... 2003, 1 1:2 83-289. 22. Gorter RC, Brake JHM, Eijkman MAJ, Hoogstraten J: Job resources in Dutch dental practice. Int Dent J 2006, 5 6:2 2-28. doi:10.1186/1478-4491-8-20 Cite this article a...
Ngày tải lên: 18/06/2014, 17:20