Báo cáo sinh học: " Happy together: genomic insights into the unique Nanoarchaeum/Ignicoccus association" pdf

... including 19 genes otherwise common to all crenarchaeal genomes, have been lost in the I. hospitalis genome [3]. The authors put forward the hypothesis that these losses may be linked to the adaptation ... significantly smaller than that of the average free-living bacteria or archaea [3]. The authors put forward the hypothesis that, as with N. equitans [6,7], the small size of...

Ngày tải lên: 06/08/2014, 18:21

... if the ribityl chain in the other structures. The distance between the pyrimidine ring and the phosphate atom in the phosphate moiety is 6.9 A ˚ . The location of this group is the same as in the structures ... binding isotherms for the inhibitors (F). The filled circles in the binding isotherms represent the experimental values of the heat change at each injection;...

Ngày tải lên: 07/03/2014, 11:20

... autocrine-paracrine effect or into the blood- stream for a systemic effect. Within the vasculature, endothelial cells are the main target for gene therapy because they are closely related with ... endothelial-specific gene expres- sion [16]. So far, there is no information available con- cerning the use of endothelial-specific promoters in the context of the baculovirus genome....

Ngày tải lên: 18/06/2014, 18:20

... in that the patagium also extends between the hind limbs and the short tail, even stretching between fingers and toes (hence the name ‘mitten-gliders’). The lower incisors are unique: the forward-leaning ... al. [8] thus provide more evidence for the hypothesis that Scandentia and Dermoptera have a closer phylogenetic relationship to each other than either of them has to Primat...

Ngày tải lên: 06/08/2014, 18:21

... hydrolysis to the formation of a thioester bond between the active-site cysteine of the E1 and the carboxyl terminus of ubiquitin. The E1 then transfers the activated ubiquitin to the active-site ... Finally, the E3, or ubiquitin-protein ligase (green), facilitates the transfer of the ubiquitin from the E2 to a lysine on the target protein (substrate, magenta). In...

Ngày tải lên: 06/08/2014, 19:21

... phenotypes in the one cell type (but were detected in the other). The set included all 160 genes identified by an RNAi phenotype in each of either S2R + (gray) or Kc 167 (black) cell types. (b) The percentage ... functional genomic analysis of animal cell form. The availability of well-annotated Drosophila genomic sequence simplifies the design of gene- specific double-strande...

Ngày tải lên: 06/08/2014, 18:20

... 5¢-CCT CTCGAGATAAGCGTGGAAGTAA TCC-3¢. The NdeI and XhoI sites (underlined) were intro- duced at the 5¢-terminus and the 3¢-terminus, respectively, of the EwA gene for cloning into the pET22b vector (Novagen). The resulting ... their therapeutic inefficiency [18]. In most of the studies, the catalytic properties of the enzymes were characterized in detail, but other importan...

Ngày tải lên: 30/03/2014, 04:20

... year in the UK amounted to 11.2% (Figure 2). Of the respondents, 88.9% had held a paid NHS post, while the remaining 11.1% had been unemployed throughout their stay in the UK. Of all the respondents, 12.9% ... 2002 (11.2%), but thereafter a drop, with 7.7% qualifying in 2003, 4% in 2004 and 0.9% in 2005 (Figure 1). The respondents were asked to report the duration of time they h...

Ngày tải lên: 18/06/2014, 17:20

... zero. Further, the salaries for all PNS is the first charge against the so-called uncon- ditional grant from the central government, further reduc- ing their overall decision space on the sector ... clinics. As the health centre was developed, the public treatment clinics were incorporated into the health centres, with the result that only the private balai pengobatan r...

Ngày tải lên: 18/06/2014, 17:20

... relation to the short-sightedness of a focus on skills in the absence of measures that demonstrate the long-term value of pop- ulation-based health care. Conclusion On the basis of the work we do together ... regardless of the suitability of the programme to the student's needs or abilities [7]. Remain- ing separate from the collaborative planning exercises described ab...

Ngày tải lên: 18/06/2014, 17:20