Báo cáo sinh học: "Imp-L2, a putative homolog of vertebrate IGF-binding protein 7, counteracts insulin signaling in Drosophila and is essential for starvation resistance" ppt
Báo cáo sinh học: "Imp-L2, a putative homolog of vertebrate IGF-binding protein 7, counteracts insulin signaling in Drosophila and is essential for starvation resistance" ppt
... functional characterization of
an insulin- binding protein in invertebrates. We have
identified Imp-L2 as a secreted antagonist of IIS in
Drosophila. Given the sequence homology of their Ig
domains, ... genetic analyses of
IIS in Drosophila and Caenorhabditis elegans have not
revealed a functional insulin- binding protein so far.
Here, we report the identification...
Báo cáo sinh học: " Motavizumab, A Neutralizing Anti-Respiratory Syncytial Virus (Rsv) Monoclonal Antibody Significantly Modifies The Local And Systemic Cytokine Responses Induced By Rsv In The Mouse Model" pdf
... 24 h before virus inoculation. Bronchoalveolar lavage (BAL) and serum samples
were obtained at days 1, 5 (acute) and 28 (long-term) post inoculation and analyzed with a multiplex
assay (Beadlyte ... review, and MBR per-
forming experiments; JC Luminex data analysis and inter-
pretation. PK and HSJ data interpretation; OR project
design, experimental analyses and interpretation...
Báo cáo sinh học: " Periostin: a promising target of therapeutical intervention for prostate cancer" potx
... TGCAGCTTCAAGTAGGCTGAGGAA
3’ ). b-actin (forward, 5’ CTGGCACCACACCTTCTA-
CAATGA 3’ and reverse, 5’ TTAATGTCACGCAC-
GATTTCCCGC 3’ ). For each pair of primers, the
following protocol was applied. Initial ... in
malignant and benign prostate tissue. A: Immunohistochemical
staining of periostin in PCa and BPH. Negative epithelial and stromal
periostin expression in BPH (a) an...
Báo cáo sinh học : "Q&A: Genetic analysis of quantitative traits" pdf
... aassssoocciiaattiioonn mmaappppiinngg??
Both methods have advantages and
disadvantages. Linkage mapping,
particularly in controlled crosses (as
opposed to, say, human families), has
the advantage of increased power ... the rapid identification of
large numbers of polymorphisms in
parental strains used in linkage-
mapping studies, or a sample of
individuals from a populatio...
Báo cáo khoa học: KCTD5, a putative substrate adaptor for cullin3 ubiquitin ligases docx
... CSIC-Universidad de Valladolid, Spain
2 Program of In ammation, In ammatory and Infectious Disease Center, and Program of Signal Transduction, Burnham Institute for Medical
Research, La Jolla, CA, USA
3 ... Inc. (Santa Cruz, CA, USA), anti-cullin 3 was
from Abcam (Cambridge, UK), and mAbs against b-actin,
PHA, FLAG M2 mAb and PMA were from Sigma Chemical
Co. (St Louis, MO, USA...
báo cáo sinh học:" Developing a competency-based curriculum in HIV for nursing schools in Haiti" pdf
... roles in
initial evaluation and staging of patients, ART initiation,
and patient monitoring [3].
As nurses are becoming increasingly central points of con-
tact for clinical care of people living ... text-
books and teaching materials and little classroom space),
variable quality of teaching with few classroom instructors
prepared to educate, and few clinical instructors...
báo cáo sinh học:" Developing a tool to measure health worker motivation in district hospitals in Kenya" pot
... exert and maintain an effort
towards attaining organizational goals [9].
Although it is likely that motivation influences perform-
ance directly and mediates or modifies the effect of inter-
ventions ... Survival in
Uganda. International Journal of Health Planning and Management
2003, 18:329-342.
33. Krogstad U, Hofoss D, Veenstra M, Hjortdahl P: Predictors of job
satisfaction...
Báo cáo sinh học: "Hypoxia-induced down-regulation of microRNA449a/b impairs control over targeted SERPINE1 (PAI-1) mRNA - a mechanism involved in SERPINE1 (PAI-1) overexpression" pptx
... needed a substantial revision
to allow a clear-cut interpretation of our findings. As
stated in the results section, hypoxia per se induces i)
down-regulation of miRNA-44 9a/ b and also miRNA-
51 8a- 3p ... Bock.Oliver@MH-Hannover.de
1
Institute of Pathology, Hannover Medical School, Carl-Neuberg-Strasse 1,
30625 Hannover, Germany
Full list of author information is available...
Báo cáo sinh học: "Enabling a robust scalable manufacturing process for therapeutic exosomes through oncogenic " ppt
... cells in acute renal injury: ca ira. Curr Opin
Pharmacol 2006, 6(2):176-183.
12. Miyahara Y, Nagaya N, Kataoka M, Yanagawa B, Tanaka K, Hao H, Ishino K,
Ishida H, Shimizu T, Kangawa K, et al: Monolayered ... tra nsplantation has been used in
clinical trials and animal models to treat musculoskeletal
injuries, improve cardiac function in cardiovascular
dis eas e and ameliorate the se...
Báo cáo sinh học: "Electroporation increases antitumoral efficacy of the bcl-2 antisense G3139 and chemotherapy in a human melanoma xenograft" pot
... following primers were used:
bcl-2 forward 5’ -GTGAACTGGGGGAGG ATTGT-3’
and reverse 5’-GGAGAAATCAAACAGAGGCC-3’ ;
GAPDH forward 5’-CCAAGGTCATCCATGACAAC-3’
and reverse 5’ -TTACTCCTTGGAGGCCATGT-3’ ... Baldi A: Patterns of tumor response in canine and feline cancer
patients treated with electrochemotherapy: preclinical data for the
standardization of this treatment in pets and...
Từ khóa:
- báo cáo khoa học sinh học
- trạng thái hiện sinh báo cáo khoa học
- báo cáo sinh thái học
- báo cáo trường học thân thiện học sinh tích cực
- mẫu báo cáo trường học thân thiện học sinh tích cực
- Báo cáo quy trình mua hàng CT CP Công Nghệ NPV
- chuyên đề điện xoay chiều theo dạng
- Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt nam
- Nghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt nam
- Biện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọ
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- Giáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôit
- ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN
- ĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN
- Phối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọ
- Trả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)
- Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ long
- Phát hiện xâm nhập dựa trên thuật toán k means
- Thiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khí
- Sở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIX
- Chuong 2 nhận dạng rui ro
- Kiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)
- Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật
- Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vật