Báo cáo sinh học: "Imp-L2, a putative homolog of vertebrate IGF-binding protein 7, counteracts insulin signaling in Drosophila and is essential for starvation resistance" ppt

Báo cáo sinh học: "Imp-L2, a putative homolog of vertebrate IGF-binding protein 7, counteracts insulin signaling in Drosophila and is essential for starvation resistance" ppt

Báo cáo sinh học: "Imp-L2, a putative homolog of vertebrate IGF-binding protein 7, counteracts insulin signaling in Drosophila and is essential for starvation resistance" ppt

... functional characterization of an insulin- binding protein in invertebrates. We have identified Imp-L2 as a secreted antagonist of IIS in Drosophila. Given the sequence homology of their Ig domains, ... genetic analyses of IIS in Drosophila and Caenorhabditis elegans have not revealed a functional insulin- binding protein so far. Here, we report the identification...

Ngày tải lên: 06/08/2014, 18:21

11 345 0
Báo cáo sinh học: " Motavizumab, A Neutralizing Anti-Respiratory Syncytial Virus (Rsv) Monoclonal Antibody Significantly Modifies The Local And Systemic Cytokine Responses Induced By Rsv In The Mouse Model" pdf

Báo cáo sinh học: " Motavizumab, A Neutralizing Anti-Respiratory Syncytial Virus (Rsv) Monoclonal Antibody Significantly Modifies The Local And Systemic Cytokine Responses Induced By Rsv In The Mouse Model" pdf

... 24 h before virus inoculation. Bronchoalveolar lavage (BAL) and serum samples were obtained at days 1, 5 (acute) and 28 (long-term) post inoculation and analyzed with a multiplex assay (Beadlyte ... review, and MBR per- forming experiments; JC Luminex data analysis and inter- pretation. PK and HSJ data interpretation; OR project design, experimental analyses and interpretation...

Ngày tải lên: 18/06/2014, 18:20

5 357 0
Báo cáo sinh học: " Periostin: a promising target of therapeutical intervention for prostate cancer" potx

Báo cáo sinh học: " Periostin: a promising target of therapeutical intervention for prostate cancer" potx

... TGCAGCTTCAAGTAGGCTGAGGAA 3’ ). b-actin (forward, 5’ CTGGCACCACACCTTCTA- CAATGA 3’ and reverse, 5’ TTAATGTCACGCAC- GATTTCCCGC 3’ ). For each pair of primers, the following protocol was applied. Initial ... in malignant and benign prostate tissue. A: Immunohistochemical staining of periostin in PCa and BPH. Negative epithelial and stromal periostin expression in BPH (a) an...

Ngày tải lên: 18/06/2014, 19:20

10 362 0
Báo cáo sinh học : "Q&A: Genetic analysis of quantitative traits" pdf

Báo cáo sinh học : "Q&A: Genetic analysis of quantitative traits" pdf

... aassssoocciiaattiioonn mmaappppiinngg?? Both methods have advantages and disadvantages. Linkage mapping, particularly in controlled crosses (as opposed to, say, human families), has the advantage of increased power ... the rapid identification of large numbers of polymorphisms in parental strains used in linkage- mapping studies, or a sample of individuals from a populatio...

Ngày tải lên: 06/08/2014, 19:20

5 361 0
Báo cáo khoa học: KCTD5, a putative substrate adaptor for cullin3 ubiquitin ligases docx

Báo cáo khoa học: KCTD5, a putative substrate adaptor for cullin3 ubiquitin ligases docx

... CSIC-Universidad de Valladolid, Spain 2 Program of In ammation, In ammatory and Infectious Disease Center, and Program of Signal Transduction, Burnham Institute for Medical Research, La Jolla, CA, USA 3 ... Inc. (Santa Cruz, CA, USA), anti-cullin 3 was from Abcam (Cambridge, UK), and mAbs against b-actin, PHA, FLAG M2 mAb and PMA were from Sigma Chemical Co. (St Louis, MO, USA...

Ngày tải lên: 07/03/2014, 06:20

11 402 0
báo cáo sinh học:" Developing a competency-based curriculum in HIV for nursing schools in Haiti" pdf

báo cáo sinh học:" Developing a competency-based curriculum in HIV for nursing schools in Haiti" pdf

... roles in initial evaluation and staging of patients, ART initiation, and patient monitoring [3]. As nurses are becoming increasingly central points of con- tact for clinical care of people living ... text- books and teaching materials and little classroom space), variable quality of teaching with few classroom instructors prepared to educate, and few clinical instructors...

Ngày tải lên: 18/06/2014, 17:20

7 377 0
báo cáo sinh học:" Developing a tool to measure health worker motivation in district hospitals in Kenya" pot

báo cáo sinh học:" Developing a tool to measure health worker motivation in district hospitals in Kenya" pot

... exert and maintain an effort towards attaining organizational goals [9]. Although it is likely that motivation influences perform- ance directly and mediates or modifies the effect of inter- ventions ... Survival in Uganda. International Journal of Health Planning and Management 2003, 18:329-342. 33. Krogstad U, Hofoss D, Veenstra M, Hjortdahl P: Predictors of job satisfaction...

Ngày tải lên: 18/06/2014, 17:20

11 446 0
Báo cáo sinh học: "Hypoxia-induced down-regulation of microRNA449a/b impairs control over targeted SERPINE1 (PAI-1) mRNA - a mechanism involved in SERPINE1 (PAI-1) overexpression" pptx

Báo cáo sinh học: "Hypoxia-induced down-regulation of microRNA449a/b impairs control over targeted SERPINE1 (PAI-1) mRNA - a mechanism involved in SERPINE1 (PAI-1) overexpression" pptx

... needed a substantial revision to allow a clear-cut interpretation of our findings. As stated in the results section, hypoxia per se induces i) down-regulation of miRNA-44 9a/ b and also miRNA- 51 8a- 3p ... Bock.Oliver@MH-Hannover.de 1 Institute of Pathology, Hannover Medical School, Carl-Neuberg-Strasse 1, 30625 Hannover, Germany Full list of author information is available...

Ngày tải lên: 18/06/2014, 19:20

5 222 0
Báo cáo sinh học: "Enabling a robust scalable manufacturing process for therapeutic exosomes through oncogenic " ppt

Báo cáo sinh học: "Enabling a robust scalable manufacturing process for therapeutic exosomes through oncogenic " ppt

... cells in acute renal injury: ca ira. Curr Opin Pharmacol 2006, 6(2):176-183. 12. Miyahara Y, Nagaya N, Kataoka M, Yanagawa B, Tanaka K, Hao H, Ishino K, Ishida H, Shimizu T, Kangawa K, et al: Monolayered ... tra nsplantation has been used in clinical trials and animal models to treat musculoskeletal injuries, improve cardiac function in cardiovascular dis eas e and ameliorate the se...

Ngày tải lên: 18/06/2014, 19:20

10 343 0
Báo cáo sinh học: "Electroporation increases antitumoral efficacy of the bcl-2 antisense G3139 and chemotherapy in a human melanoma xenograft" pot

Báo cáo sinh học: "Electroporation increases antitumoral efficacy of the bcl-2 antisense G3139 and chemotherapy in a human melanoma xenograft" pot

... following primers were used: bcl-2 forward 5’ -GTGAACTGGGGGAGG ATTGT-3’ and reverse 5’-GGAGAAATCAAACAGAGGCC-3’ ; GAPDH forward 5’-CCAAGGTCATCCATGACAAC-3’ and reverse 5’ -TTACTCCTTGGAGGCCATGT-3’ ... Baldi A: Patterns of tumor response in canine and feline cancer patients treated with electrochemotherapy: preclinical data for the standardization of this treatment in pets and...

Ngày tải lên: 18/06/2014, 22:20

10 483 0
w