Báo cáo sinh học: "Budding viral hijackers co-opt the endocytic machinery to make a getaway" pps
... known as the particle-making machine because it can assemble and bud in the absence of other viral proteins. Hence, any Research news Budding viral hijackers co-opt the endocytic machinery to make a ... components of the host endocytic pathway in order to escape the cell. The retroviral Gag protein is the key player in the process of virion assembly at t...
Ngày tải lên: 06/08/2014, 18:20
... Djibuti 2 Address: 1 Leslie Dan Faculty of Pharmacy, University of Toronto, Canada and 2 Curatio International Foundation, Tbilisi, Georgia Email: Laura C Esmail* - laura.esmail@utoronto.ca; Jillian ... media coverage about the potential adverse effects of vaccination, a low awareness in the population about the benefits of vaccination, and neurologists advis- ing their patients aga...
Ngày tải lên: 18/06/2014, 17:20
... group labo- ratory technicians and laboratory technologists in a category that we call "laboratory staff", and we group pharmacists and pharmaceutical technologists in a cate- gory that ... doctors and clinical officers; retirement accounts for the main share of attrition among nurses and pharmacy staff; and death is the primary reason for attrition among laboratory staff, p...
Ngày tải lên: 18/06/2014, 17:20
Báo cáo sinh học: " Universal primers for HBV genome DNA amplification across subtypes: a case study for designing more effective viral primer" potx
... Sequence ORF located in 8~26 ACCTCTGCCTAATCATCTC X/preC 40~68 ACTGTTCAAGCCTCCAAGCTGTGCCTTGG preC 591~616 GCCGCGTCGCAGAAGATCTCAATCTC Terminal Protein 993~1018 GGGTCACCATATTCTTGGGAACAAGA Terminal Protein 1450~1469 ... CCTGCTGGTGGCTCCAGTTC pre-S2 1571~1592 TCCTAGGACCCCTGCTCGTGTT S 1657~1679 ACTTCTCTCAATTTTCTAGGGGG S 2131~2159 TATATGGATGATGTGGTATTGGGGGCCAA S 2491~2516 TTCTCGCCAACTTACAAGGCCTTTCT R...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo sinh học: " Overcoming viral escape with vaccines that generate and display antigen diversity in vivo Albert García-Quintanilla" pot
... Access Hypothesis Overcoming viral escape with vaccines that generate and display antigen diversity in vivo Albert Garc a- Quintanilla Address: Atanasio Barrón 14, P4- 5A, 41003 Sevilla, Spain Email: Albert Garc a- Quintanilla ... that bears the appropriate cis packing and replication motifs. A particular example of this last would be the use of S. cerevisiae carrying L -A totivirus...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo sinh học: " Plant viral intergenic DNA sequence repeats with transcription enhancing activity" pot
... (repeated palindrome) BCTV DR (repeated palindrome) DR19 aagcttctagaCGAAACTTCCTGAAGAAGATTCTGAAGA /TAATCCGAAACTTCCTGAAGAAGATTCTggatcctcgag DR30 aagcttctagaAAACTTgCTGTGTAAGTTTGAAGA/ /TAATCAAACTTCCTaTGTAAGTTTggatcctcgag Consensus ... aagcttctagaAATGACGTCATTTggatcctcgag PAL10 aagcttctagaTAAATACCTATACGTATTCGTATAGCTATTTAggatcctcgag DR14 aagcttGGCCCATTTGGAGAAGA/ /TAATCGGCCCATTTGGActcgag DR34 aagc...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo sinh học: " Stimulation of poliovirus RNA synthesis and virus maturation in a HeLa cell-free in vitro translation-RNA replication system by viral protein 3CDpro" docx
... a filter-binding assay. As shown in Fig. 2A, RNA synthesis is maximal 8 hrs after the start of transla- tion and by 16 hr the total amount of RNA present in the reaction decreases. At the peak ... trans- lation-RNA replication reactions, programmed with viral RNA, enhances total RNA synthesis about 3 fold [9]. The addition of 3CD pro , however, had no effect on the transla- t...
Ngày tải lên: 19/06/2014, 08:20
báo cáo sinh học:" Nurses'''' experiences of recruitment and migration from developing countries: a phenomenological approach" pdf
... was obtained from the Director of Nursing to gain access to nursing staff in the DATH, and informed consent was obtained from all participants. Data analysis A 'bottom up' approach to ... stated: " they are not nurses in their hearts how can we make them nurses?" The IDNs also acknowledged that nurses traditionally joined the profession as they saw it as...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" Initial community perspectives on the Health Service " ppt
... contributed to the design, analysis, and write up. All authors read and approved the final manu- script. Acknowledgements We are very grateful to Tigray Health Bureau, Welkait Woreda Health Office and ... important that the gaps in their knowledge and in particular their abilities to impart infor- mation are addressed in the training and support of HEWs. This study points to...
Ngày tải lên: 18/06/2014, 17:20
báo cáo sinh học:" Effective scale-up: avoiding the same old traps" doc
... pro- vides the data health care leaders and managers need to answer key policy questions affecting health care service delivery and to plan rationally for who should be trained and in what areas. An ... pitfalls have become more serious and are now seen as aggravating the situation and impeding the effective scale-up of training. On 9 January 2008, partici- pants in a meeting with...
Ngày tải lên: 18/06/2014, 17:20