Báo cáo sinh học: "The small number of journals in which a great number of scientists strive to publish their best work share certain characteristics" doc

Báo cáo khoa học: Adeno-associated virus gene transfer in Morquio A disease – effect of promoters and sulfatase-modifying factor 1 pot

Báo cáo khoa học: Adeno-associated virus gene transfer in Morquio A disease – effect of promoters and sulfatase-modifying factor 1 pot

... were cotransduced with 1 · 10 10 vg of CMV–GALNS, AAT–GALNS or EF1–GALNS, and CMV–SUMF1 in a 1 : 0, 1 : 1 or 1 : 2 ratio. Activ- ity in cell lysates and culture media was assayed 4 days post-trans- duction. ... silencing and the immune response to the transgene product [1 1 1 3]. Eukaryotic promoters [e.g. elongation factor 1a (EF1), muscular creatine kinase,...

Ngày tải lên: 29/03/2014, 21:20

12 461 0
báo cáo sinh học:" The role of regulation in influencing income-generating activities among public sector doctors in Peru" doc

báo cáo sinh học:" The role of regulation in influencing income-generating activities among public sector doctors in Peru" doc

... and furthermore, widely acknowledged. The motivation for such activities is typically financial. In terms of why such doctors continue to maintain their primary roles in the public sector, the main ... employment (rather than working exclusively in the private sector) a number of reasons were posited. The income from a job in the public sector was seen to b...

Ngày tải lên: 18/06/2014, 17:20

8 497 0
báo cáo sinh học:" The College of Medicine in the Republic of Malawi: towards sustainable staff development" docx

báo cáo sinh học:" The College of Medicine in the Republic of Malawi: towards sustainable staff development" docx

... help from the Royal Colleges in the UK in developing this initiative. In the 'Part I' period of training in Malawi the students work as registrars in their designated department. The COM ... Central Page 1 of 5 (page number not for citation purposes) Human Resources for Health Open Access Research The College of Medicine in the Republic of Ma...

Ngày tải lên: 18/06/2014, 17:20

5 456 0
báo cáo sinh học:" The training and expectations of medical students in Mozambique" doc

báo cáo sinh học:" The training and expectations of medical students in Mozambique" doc

... having uncles and/ or aunts that were associated with the health profession, with 24% having friends working in the discipline and 30% noting other reference people similarly involved. The main ... reported the public sector, 40% the private for profit sector and 21% the private not for profit sector. Of 186 students who preferred the public sector, 36% indicated th...

Ngày tải lên: 18/06/2014, 17:20

7 494 0
báo cáo sinh học:" Increasing health worker capacity through distance learning: a comprehensive review of programmes in Tanzania" ppt

báo cáo sinh học:" Increasing health worker capacity through distance learning: a comprehensive review of programmes in Tanzania" ppt

... mobile phones. Challenges and constraints of distance learning programmes for health care workers Distance learning in Tanzania faces many challenges and constraints. Resources are inadequate, including funding, ... se of health care worker in- service training, qualifications upgrading, and post gradu- ate training as a way to motivate and retain health care workers....

Ngày tải lên: 18/06/2014, 17:20

10 438 0
Báo cáo sinh học: " Medical education and research environment in Qatar: a new epoch for translational research in the Middle East" pptx

Báo cáo sinh học: " Medical education and research environment in Qatar: a new epoch for translational research in the Middle East" pptx

... 9:16 http://www .translational- medicine.com/content/9/1/16 Page 3 of 8 REVIEW Open Access Medical education and research environment in Qatar: a new epoch for translational research in the Middle East Lotfi Chouchane 1* , Ravinder ... Qatar. Biomedical and Translational Research WCMC-Q’ s research program aims to a) build a self- sustaining core of...

Ngày tải lên: 18/06/2014, 19:20

8 375 0
Báo cáo sinh học: "The iSBTc/SITC primer on tumor immunology and biological therapy of cancer: a summary of the 2010 program" doc

Báo cáo sinh học: "The iSBTc/SITC primer on tumor immunology and biological therapy of cancer: a summary of the 2010 program" doc

... development and application of biological therapy and immunotherapy. The society and its educational programs have become premier destinations for interaction and innovation in the cancer biologics ... original work is properly cited. The iSBTc/SITC primer on tumor immunology and biological therapy of cancer: a summary of the 2010 program Bal...

Ngày tải lên: 18/06/2014, 19:20

15 602 0
báo cáo hóa học: " The longitudinal link between visual acuity and health-related quality of life in patients with diabetic retinopathy" doc

báo cáo hóa học: " The longitudinal link between visual acuity and health-related quality of life in patients with diabetic retinopathy" doc

... and Quality of Life Outcomes Open Access Research The longitudinal link between visual acuity and health-related quality of life in patients with diabetic retinopathy Louis S Matza* 1 , Matthew ... examine the rela- tionship between change in visual acuity defined as a con- tinuous variable and change in the VFQ-25 scales, controlling for...

Ngày tải lên: 18/06/2014, 19:20

10 523 0
báo cáo hóa học:" The longitudinal link between visual acuity and health-related quality of life in patients with diabetic retinopathy pot

báo cáo hóa học:" The longitudinal link between visual acuity and health-related quality of life in patients with diabetic retinopathy pot

... and Quality of Life Outcomes Open Access Research The longitudinal link between visual acuity and health-related quality of life in patients with diabetic retinopathy Louis S Matza* 1 , Matthew ... this link over time. Thus, the purpose of the current study was to examine the degree of change in HRQL that is associated with visual acu...

Ngày tải lên: 20/06/2014, 16:20

10 474 0
Báo cáo sinh học: "The short coiled-coil domain-containing protein UNC-69 cooperates with UNC-76 to regulate axonal outgrowth and normal presynaptic organization in Caenorhabditis elegans" ppt

Báo cáo sinh học: "The short coiled-coil domain-containing protein UNC-69 cooperates with UNC-76 to regulate axonal outgrowth and normal presynaptic organization in Caenorhabditis elegans" ppt

... and Tharin et al. 9.3 Journal of Biology 2006, 5:9 Research article The short coiled-coil domain-containing protein UNC-69 cooperates with UNC-76 to regulate axonal outgrowth and normal presynaptic ... 32 40 20 0 (a) (b) (f) (g) (h) (i) (l) (k) (m) (n) (j) (c) (d) (e) UNC-69 and UNC-76 interact in vivo We identified UNC-76 as an UNC-69- interacting...

Ngày tải lên: 06/08/2014, 18:21

26 399 0
Báo cáo y học: "Two specific drugs, BMS-345541 and purvalanol A induce apoptosis of HTLV-1 infected cells through inhibition of the NF-kappaB and cell cycle pathways" ppsx

Báo cáo y học: "Two specific drugs, BMS-345541 and purvalanol A induce apoptosis of HTLV-1 infected cells through inhibition of the NF-kappaB and cell cycle pathways" ppsx

... Watanabe M, Ohsugi T, Shoda M, Ishida T, Aizawa S, Maruyama-Nagai M, Utsunomiya A, Koga S, Yamada Y, Kamihira S, Okayama A, Kikuchi H, Uozumi K, Yamaguchi K, Higashihara M, Umezawa K, Watanabe ... Research and Therapy Open Access Research Two specific drugs, BMS-345541 and purvalanol A induce apoptosis of HTLV-1 infected cells through inhibition of the NF...

Ngày tải lên: 10/08/2014, 05:21

16 391 0
báo cáo khoa học: " The NAC domain-containing protein, GmNAC6, is a downstream component of the ER stress- and osmotic stress-induced NRP-mediated cell-death signaling pathway" pptx

báo cáo khoa học: " The NAC domain-containing protein, GmNAC6, is a downstream component of the ER stress- and osmotic stress-induced NRP-mediated cell-death signaling pathway" pptx

... RESEARC H ARTIC L E Open Access The NAC domain-containing protein, GmNAC6, is a downstream component of the ER stress- and osmotic stress-induced NRP-mediated cell-death signaling pathway Jerusa ... contributions JAQA carried out the experiments, the statistical analysis of the data and drafted the manuscript. MTBR and PABR assisted directly...

Ngày tải lên: 11/08/2014, 11:21

14 254 0
báo cáo khoa học: " The redox-sensitive transcription factor Rap2.4a controls nuclear expression of 2-Cys peroxiredoxin A and other chloroplast antioxidant enzymes" pps

báo cáo khoa học: " The redox-sensitive transcription factor Rap2.4a controls nuclear expression of 2-Cys peroxiredoxin A and other chloroplast antioxidant enzymes" pps

... 2CPA translation start site was PCR amplified in five fragments using the primers AAACCATGGCATGCATAAGAGTC and TCCGGGAAATCCAGG for fragment 1, AAACCAT- GGCATGCATAAGAGTC and GATGACGGAGATGATG for fragment 2, ... TCTCCGTCATCGAAC and GCAGAGTTTCT- GGGT for fragment 3, AAACCATGGAATACCCAGAAACT and GCGTGACCGGAGACATG for fragment 4 and CTC- CGGTCACGCGATTCAAC and CTCTCTTCACTTGGTT- TAC for...

Ngày tải lên: 12/08/2014, 05:20

14 247 0
Báo cáo sinh học: "An FPT haplotyping algorithm on pedigrees with a small number of sites" ppsx

Báo cáo sinh học: "An FPT haplotyping algorithm on pedigrees with a small number of sites" ppsx

... :8 http://www.almob.org/content/6/1/8 Page 3 of 8 RESEARC H Open Access An FPT haplotyping algorithm on pedigrees with a small number of sites Duong D Doan and Patricia A Evans * Abstract Background: ... Algorithm Engineering for Optimal Graph Bipartization. Journal of Graph Algorithms and Applications 2010, 13(2):77-98. doi:10.1186/1748-7188-6-8 Cite this article...

Ngày tải lên: 12/08/2014, 17:20

8 241 0
Từ khóa:
w