Báo cáo sinh học: "The small number of journals in which a great number of scientists strive to publish their best work share certain characteristics" doc
Báo cáo khoa học: Adeno-associated virus gene transfer in Morquio A disease – effect of promoters and sulfatase-modifying factor 1 pot
... werecotransduced with 1 · 10 10 vg of CMV–GALNS, AAT–GALNS orEF1–GALNS, and CMV–SUMF1 in a 1 : 0, 1 : 1 or 1 : 2 ratio. Activ-ity in cell lysates and culture media was assayed 4 days post-trans-duction. ... silencing and theimmune response to the transgene product [1 1 1 3].Eukaryotic promoters [e.g. elongation factor 1a (EF1),muscular creatine kinase, and a 1 -antitrypsin (AAT)]have emerged as alternatives ... al.3 618 FEBS Journal 277 (2 010 ) 36083 619 ê 2 010 The Authors Journal compilation ê 2 010 FEBS Adeno-associated virus gene transfer in Morquio A disease – effect of promoters and sulfatase-modifying factor...
- 12
- 460
- 0
báo cáo sinh học:" The role of regulation in influencing income-generating activities among public sector doctors in Peru" doc
... andfurthermore, widely acknowledged. The motivation forsuch activities is typically financial. In terms of why such doctors continue to maintain their primary roles in the public sector, the main ... employment (rather than working exclusively in the private sector) a number of reasons were posited. The income from a job in the public sector was seen to bringsecurity to doctors by offering a monthly ... dif-ferences in interpretation of the regulations.Against this background, this paper aims through inter-views with doctors to examine the nature of such activities in Peru, determine the manner in which...
- 8
- 496
- 0
báo cáo sinh học:" The College of Medicine in the Republic of Malawi: towards sustainable staff development" docx
... help from the Royal Colleges in the UK in developing this initiative. In the 'Part I' period of training in Malawi the studentswork as registrars in their designated department. The COM ... CentralPage 1 of 5(page number not for citation purposes)Human Resources for HealthOpen AccessResearch The College of Medicine in the Republic of Malawi: towards sustainable staff developmentEd ... departments, taking into account a 65% increase in staff to cope withincreasing numbers of students.Conclusion: There seems to be no significant brain drain among graduates of the COM. The postgraduate...
- 5
- 456
- 0
báo cáo sinh học:" The training and expectations of medical students in Mozambique" doc
... having uncles and/ or aunts that were associated with the health profession,with 24% having friends working in the discipline and 30% noting other reference people similarly involved. The main ... reported the public sector, 40% the private for profit sector and 21% the private not for profitsector. Of 186 students who preferred the public sector, 36%indicated the intention of combining a ... planned in the "2003–2005 Strategic Plan of the Faculty" is currently being implemented [2].Concerning the selection of medical students, there are – in several countries including some in...
- 7
- 493
- 0
báo cáo sinh học:" Increasing health worker capacity through distance learning: a comprehensive review of programmes in Tanzania" ppt
... mobilephones.Challenges and constraints of distance learning programmes for health care workers Distance learning in Tanzania faces many challengesand constraints. Resources are inadequate, includingfunding, ... se of health care worker in- service training, qualifications upgrading, and post gradu-ate training as a way to motivate and retain health careworkers. A r eview of 16 countries in east and ... learn-ing upgrade programmes increases both the residentialand classroom space available at health training institu-tions for pre-service training. One health training insti-tution principal said,...
- 10
- 438
- 0
Báo cáo sinh học: " Medical education and research environment in Qatar: a new epoch for translational research in the Middle East" pptx
... 9:16http://www .translational- medicine.com/content/9/1/16Page 3 of 8 REVIEW Open Access Medical education and research environment in Qatar: a new epoch for translational research in the Middle EastLotfi Chouchane1*, Ravinder ... Qatar.Biomedical and Translational Research WCMC-Q’ s research program aims to a) build a self-sustaining core of top biomedical scientists by recruit-ing, retaining, and training t optalents,andb)establishstrong ... organization,whose mission is “to prepare the people of Qatar and the region to meet the challenges of an ever -changing world, and to make Qatar a leader in innovative education and research. ”...
- 8
- 375
- 0
Báo cáo sinh học: "The iSBTc/SITC primer on tumor immunology and biological therapy of cancer: a summary of the 2010 program" doc
... development and application of biological therapy and immunotherapy. The society and its educational programs have become premierdestinations for interaction and innovation in the cancer biologics ... original work is properly cited. The iSBTc/SITC primer on tumor immunology and biological therapy of cancer: a summary of the 2010 programBalwit et al.Balwit et al. Journal of Translational Medicine ... inflammation. The following generalizationsfurther illustrate this circular nature of the relationshipbetween inflammation and cancer: inflammation cancause cancer; inflammation can cause mutation;...
- 15
- 602
- 0
báo cáo hóa học: " The longitudinal link between visual acuity and health-related quality of life in patients with diabetic retinopathy" doc
... and Quality of Life OutcomesOpen AccessResearch The longitudinal link between visual acuity and health-related quality of life in patients with diabetic retinopathyLouis S Matza*1, Matthew ... examine the rela-tionship between change in visual acuity defined as a con-tinuous variable and change in the VFQ-25 scales,controlling for age, gender, and visual acuity at baseline. In all ... this link over time. Thus, the purpose of the current study was to examine the degree of change in HRQL that is associated with visual acuity changes among patients with diabetic retinopathy. Patients...
- 10
- 523
- 0
báo cáo hóa học:" The longitudinal link between visual acuity and health-related quality of life in patients with diabetic retinopathy pot
... and Quality of Life OutcomesOpen AccessResearch The longitudinal link between visual acuity and health-related quality of life in patients with diabetic retinopathy Louis S Matza*1, Matthew ... this link over time. Thus, the purpose of the current study was to examine the degree of change in HRQL that is associated with visual acuity changes among patients with diabetic retinopathy. Patients ... characterized the degree of change in health-related quality of life (HRQL) associated with change in visual acuity among patients with diabetic retinopathy. Methods: Data are from a randomized,...
- 10
- 474
- 0
Báo cáo sinh học: "The short coiled-coil domain-containing protein UNC-69 cooperates with UNC-76 to regulate axonal outgrowth and normal presynaptic organization in Caenorhabditis elegans" ppt
... and Tharin et al. 9.3Journal of Biology 2006, 5:9 Research articleThe short coiled-coil domain-containing protein UNC-69 cooperates with UNC-76 to regulate axonal outgrowth and normal presynaptic ... 3240200(a)(b)(f)(g)(h)(i)(l)(k)(m)(n)(j)(c)(d)(e) UNC-69 and UNC-76 interact in vivoWe identified UNC-76 as an UNC-69- interacting protein. UNC-76 is required for axonal outgrowth and fasciculation in worms and its homolog in Drosophila ... of UNC-69 in mediating post-Golgitransport UNC-69 is not predicted to have enzymatic activity and pos-sibly functions only by interacting with other coiled-coil domain-containing proteins....
- 26
- 399
- 0
Báo cáo y học: "Two specific drugs, BMS-345541 and purvalanol A induce apoptosis of HTLV-1 infected cells through inhibition of the NF-kappaB and cell cycle pathways" ppsx
... Watanabe M, Ohsugi T, Shoda M, Ishida T, Aizawa S, Maruyama-NagaiM, Utsunomiya A, Koga S, Yamada Y, Kamihira S, Okayama A, KikuchiH, Uozumi K, Yamaguchi K, Higashihara M, Umezawa K, Watanabe ... Research and TherapyOpen AccessResearchTwo specific drugs, BMS-345541 and purvalanol A induce apoptosis of HTLV-1 infected cells through inhibition of the NF-kappaB and cell cycle pathwaysEmmanuel ... N, Yamada Y, Ikeda S, Yamasaki Y, Tsukasaki K, Tanaka Y, Tomonaga M, Yamamoto N, Fujii M: Bay 11-7082 inhibits tran-scription factor NF-kappaB and induces apoptosis of HTLV-I -infected T-cell...
- 16
- 391
- 0
báo cáo khoa học: " The NAC domain-containing protein, GmNAC6, is a downstream component of the ER stress- and osmotic stress-induced NRP-mediated cell-death signaling pathway" pptx
... RESEARC H ARTIC L E Open Access The NAC domain-containing protein, GmNAC6, is a downstream component of the ER stress- and osmotic stress-induced NRP-mediated cell-death signaling pathwayJerusa ... contributionsJAQA carried out the experiments, the statistical analysis of the data and drafted the manuscript. MTBR and PABR assisted directly the qRT-PCR assays and the caspase 3-like activity experiment.GLR ... phenotypes, and acts antagonistically tosuppress ABA-mediated responses. As ABA is a centralregulator of plant adaptation to drought [30,31] and plays a crucial role in the regulati on of transpirationalwater...
- 14
- 254
- 0
báo cáo khoa học: " The redox-sensitive transcription factor Rap2.4a controls nuclear expression of 2-Cys peroxiredoxin A and other chloroplast antioxidant enzymes" pps
... 2CPAtranslation start site was PCR amplified in five fragmentsusing the primers AAACCATGGCATGCATAAGAGTC and TCCGGGAAATCCAGG for fragment 1, AAACCAT-GGCATGCATAAGAGTC and GATGACGGAGATGATG forfragment 2, ... TCTCCGTCATCGAAC and GCAGAGTTTCT-GGGT for fragment 3, AAACCATGGAATACCCAGAAACT and GCGTGACCGGAGACATG for fragment 4 and CTC-CGGTCACGCGATTCAAC and CTCTCTTCACTTGGTT-TAC for fragment 5. To generate ... Rap2.6 were ampli-fied by RT-PCR using the primers Rap2.4-S (ATGGCG-GATCTCTTCGGTG), Rap2.4 -A (TCACGATAAAATTGAAGCCC), Rap2.6-S (ATGGTGTC-TATGCTGACTAATG) and Rap2.6 -A (GTTAGTTAAC-CAAAAGAGGAG),...
- 14
- 247
- 0
Báo cáo sinh học: "An FPT haplotyping algorithm on pedigrees with a small number of sites" ppsx
... :8http://www.almob.org/content/6/1/8Page 3 of 8 RESEARC H Open AccessAn FPT haplotyping algorithm on pedigrees with a small number of sitesDuong D Doan and Patricia A Evans*AbstractBackground: ... Algorithm Engineering for Optimal Graph Bipartization. Journal of Graph Algorithms and Applications 2010, 13(2):77-98.doi:10.1186/1748-7188-6-8Cite this article as: Doan and Evans: An FPT haplotyping ... description data of the twocopies are called a genotype while those of a single copyare called a haploty pe. A specific location in a chromo-some is called a site and its state is called an allele.There...
- 8
- 241
- 0
Từ khóa: Báo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiNghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngĐịnh tội danh từ thực tiễn huyện Cần Giuộc, tỉnh Long An (Luận văn thạc sĩ)Tổ chức và hoạt động của Phòng Tư pháp từ thực tiễn tỉnh Phú Thọ (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015