Thành ngữ Buy a Pig in a Poke ppsx

Displaying an Image from a Database in a Web Forms Control

Displaying an Image from a Database in a Web Forms Control

... statement to retrieve the required image from the database and retrieve the image using a DataReader. A DataTable or DataSet filled using a DataAdapter can also be used. 3. Set the ContentType property ... display an image from a database column in an ASP.NET control. Solution Fill an ASP.NET Image control from a database field by pointing the ImageUrl property of an Image c...

Ngày tải lên: 28/10/2013, 18:15

3 442 0
Displaying an Image from a Database in a Windows Forms Control

Displaying an Image from a Database in a Windows Forms Control

... within the data source, such as a row in a DataTable. The BindingContext class is used to instantiate a BindingManagerBase object and either a CurrencyManager or PropertyManager object is ... returned depending on the type of data source: • The CurrencyManager class inherits from the BindingManagerBase class and maintains a pointer for the current item in a data source t...

Ngày tải lên: 28/10/2013, 18:15

5 391 0
Đề tài " The distribution of integers with a divisor in a given interval " ppt

Đề tài " The distribution of integers with a divisor in a given interval " ppt

... the author enjoyed the hospitality of the Institute of Mathematics and Informatics, Bulgarian Academy of Sciences. Finally, the author acknowledges the referee for a thorough reading of the paper ... primes play an important role in many number theoretic applications, especially in the areas of primality testing, integer factorization and cryptography. Upper bounds for H(x, y, z; P λ )...

Ngày tải lên: 06/03/2014, 08:21

68 409 0
Báo cáo khoa học: "Techniques to incorporate the benefits of a Hierarchy in a modified hidden Markov model" pptx

Báo cáo khoa học: "Techniques to incorporate the benefits of a Hierarchy in a modified hidden Markov model" pptx

... graph of micro-average F -measure against the number of training sentences during text chunking (A: MHHMM, B: HHMM and C: HMM) The first finding is that the size of training data dramatically affects ... model makes no use of the word infor- mation contained in the sentence. 4.2 Grammar Parsing Creation of a parse tree involves describing lan- guage grammar in a tree representation, whe...

Ngày tải lên: 08/03/2014, 02:21

8 528 0
Báo cáo hóa học: " Kinematic analysis of the daily activity of drinking from a glass in a population with cervical spinal cord injury" potx

Báo cáo hóa học: " Kinematic analysis of the daily activity of drinking from a glass in a population with cervical spinal cord injury" potx

... with cervical SCI. Acknowledgements This work was part of a project financed by FISCAM (Fundación para la Investigación Sanitaria de Castilla-La Mancha, Spain) which does not have any commercial interest ... the drinking task cycle) when the movement was recorded. Statistical analysis A descriptive analysis was made of the clinical and func- tional variables by calculating the median and...

Ngày tải lên: 19/06/2014, 08:20

12 608 1
Đặc điểm ngữ pháp và ngữ nghĩa của con số trong thành ngữ, tục ngữ, ca dao việt nam

Đặc điểm ngữ pháp và ngữ nghĩa của con số trong thành ngữ, tục ngữ, ca dao việt nam

... CON SỐ TRONG THÀNH NGỮ, TỤC NGỮ, CA DAO 75 3.1. Bước đầu khảo sát ý ngh a c a con số trong thành ngữ, tục ngữ, ca dao 78 3.2. Ngh a gốc c a con số trong thành ngữ, tục ngữ, ca dao 76 3.2.1. ... nhân bàn đến những vấn đề khác c a thành ngữ, tục ngữ, ca dao (như khi nói về nội dung c a ca dao, thi pháp ca dao, cấu trúc c a thành ngữ, tục ngữ, ca dao ) mà ch a có mộ...

Ngày tải lên: 26/12/2013, 15:27

149 3,8K 22
Tài liệu 168 thành ngữ tiếng Anh bắt đầu bằng chữ A docx

Tài liệu 168 thành ngữ tiếng Anh bắt đầu bằng chữ A docx

... insult to injury : câu thành ngữ này tương tự với câu thành ngữ trên.: làm cho tình huống xấu trở nên tồi tệ hơn 7. After your own heart: có cách nghĩ giống nhau 8. Against the clock: bạn đang ... mật…) 15. Albatross around your neck: hậu quả, vấn đề nảy sinh từ những việc bạn đã làm, dẫn đến thất bại 16. Alike as two peas: giống nhau như hai giọt nước ( hai hạt đậu) 17. Alive and...

Ngày tải lên: 20/01/2014, 17:20

2 1,8K 8
How to attract interests and involvement of the 9th graders in a speaking lessons at Minh Thanh secondary in Quang Ninh

How to attract interests and involvement of the 9th graders in a speaking lessons at Minh Thanh secondary in Quang Ninh

... speaking in general and teaching speaking in particular. In the Chapter 2, we will investigate how speaking lessons are dealt with by teachers and students in Minh Thanh secondary school in ... they are grouped with those having the same language, and particularly talking in small groups because they find it easier and more natural to speak their mother tongue than a foreig...

Ngày tải lên: 15/03/2014, 10:03

119 527 1
Báo cáo sinh học: " Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide" pptx

Báo cáo sinh học: " Prevention of genital herpes in a guinea pig model using a glycoprotein D-specific single chain antibody as a microbicide" pptx

... TAYTTTAAAARGTGTCMAGTGT Gamma 12 CTYTTAAAAGGKGTCCAGWG Gamma 13 CYTTTAMATGGTATCCAGTGT Gamma 14 ATGGCAGCWGCYCAAAG Gamma 15 CTTTTAAAAGWTGTCCAGKGT Gamma 16 CTTCCTGATGGCAGTGGTT C region gamma primer TAACCCTTGACCAGGCATCC Key ... kappa primer TGGTGGGAAGATGGA Signal sequence/framework primers Gamma 1 GAGGTGAAGCTGCAGGAGTCAGGACCTAGCCTGGTG Gamma 2 AGGTVMAACTGCAGVAGTCWGG Gamma 3 AGGTVVAGCTGCAGVAGTCWGG Gam...

Ngày tải lên: 18/06/2014, 22:20

10 541 0
Báo cáo sinh học: " Cyclic cidofovir (cHPMPC) prevents congenital cytomegalovirus infection in a guinea pig model" pdf

Báo cáo sinh học: " Cyclic cidofovir (cHPMPC) prevents congenital cytomegalovirus infection in a guinea pig model" pdf

... capable of infecting the fetus, inducing disease and mortality, following exper- imental inoculation of pregnant guinea pigs. Maternal and fetal GPCMV disease and mortality was abrogated by antiviral ... mg/kg) was administered to 4 animals, and saline diluent (negative control) was administered to 5 animals. Antiviral drug was administered in a single dose, via intraperitoneal route, 24...

Ngày tải lên: 19/06/2014, 08:20

7 224 0
w