... CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAAGAGACGGTGACCATTGTCCC JH4-5.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCAGGGTTCC JH6.link CCACCAGAACCTCCGCCTCCTGATCCGCCACCTCCTGAGGAGACGGTGACCGTGGTCCC L. ... GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGACATCGTGATGACCCAGTCTCC VK5.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAACGACACTCACGCAGTCTCC VK6.link GGCGGATCAGGAGGCGGAGGTTCTGGTGGAGGTGGGAGTGAAAT...
Ngày tải lên: 23/03/2014, 13:20
... Ishii A, Ohta M, Watanabe Y, Matsuda K, Ishiyama K, Sakoe K, Nakamura M, Inokuchi J, Sanai Y & Saito M (1998) Expression cloning and functional char- acterization of human cDNA for ganglioside ... (Takara Bio, Shiga, Japan). The DNA insert in each plasmid construct was verified by sequencing. Establishment of stable transfectants and the luciferase assay An aliquot of 0.4 lg of...
Ngày tải lên: 30/03/2014, 01:20
Báo cáo y học: "Pre-hospital intubation by anaesthesiologists in patients with severe trauma: an audit of a Norwegian helicopter emergency medical service"
... methods Stavanger HEMS The Stavanger HEMS is part of the national HEMS system of Norway, and its primary areas of operation are the mixed urban and rural districts of Rogaland County, which consist of ... of anaesthesiologist-managed pre-hospital ETI in trauma * Correspondence: solste@snla.no 1 Department of Research and Development, Norwegian Air Ambulance Foundation, Drøbak, N...
Ngày tải lên: 25/10/2012, 09:56
DE VA DAP AN TOAN KHOI A - 2009.doc
... 2 3a 1 1 3a 3a 6a 3a 3 IE CJ IE SE ,SI 4 2 CJ 2 5 5 5 = = × ⇒ = = ⇒ = = , [ ] 3 1 1 3a 3 3a 15 V a 2a 2a 3 2 5 5 = + = ÷ A B D C I J E H N S ∆ ABC = · 1 IA.IB.sin AIB 2 = sin · AIB Do ... Cho hình chóp S.ABCD có đáy ABCD là hình thang vuông tại A và D; AB = AD = 2a; CD = a; góc gi a hai mặt phẳng (SBC) và (ABCD) bằng 60 0 . Gọi I là trung điểm c a cạnh AD. B...
Ngày tải lên: 30/08/2013, 22:10
DE + DAP AN TOAN KHOI A - 2009.doc
... Cho hình chóp S.ABCD có đáy ABCD là hình thang vuông tại A và D; AB = AD = 2a; CD = a; góc gi a hai mặt phẳng (SBC) và (ABCD) bằng 60 0 . Gọi I là trung điểm c a cạnh AD. Biết hai mặt phẳng (SBI) ... tại hai điểm phân biệt A, B. Kẻ đường cao IH c a ∆ABC, ta có S ∆ ABC = · 1 IA.IB.sin AIB 2 = sin · AIB Do đó S ∆ ABC lớn nhất khi và chỉ khi sin · AIB = 1 ⇔ ∆AIB vuông tại I ⇔ IH =...
Ngày tải lên: 30/08/2013, 22:10
Gián án Visit from a pen pal
... 10’ 3’ - T calls 1 or 2 pairs to present. - T evaluates. Teaching date: Week :1 Period: 2 English 9
Ngày tải lên: 29/11/2013, 15:12
Tài liệu Proportions of a Hand docx
... http://www.finearteducation.com and http://www.drawspace.com - 2 - INTRODUCTION Human hands are without doubt very anatomically intricate, but not nearly as difficult to draw as many artists assume. ... illustration. Imagine each hand open to a point where you can compare the length of the fingers to the length of the main section of the hand. Again the distances are approximatel...
Ngày tải lên: 14/12/2013, 15:16
Tài liệu Lab 3.1.1 Safe Handling and Use of a Multimeter docx
... Because it is possible to check high voltages, extra care should be taken to avoid electrical shock. Step 1 Insert the red and black leads into the proper jacks on the meter. a. The black ... voltage measurement. a. What is the symbol for this? ___________________ Step 5 Put the tip of the red, positive lead on the positive side of a battery. Put the tip of the black, negativ...
Ngày tải lên: 21/12/2013, 19:15
Tài liệu Eye of a Dog docx
... Drawing People: Winner of the Alpha-Penguin Book of the Year Award 2004, Alpha - Pearson Education – Macmillan, Indianapolis, IN, this 360 page book is available on various websites and in major ... was awarded a Certificate of Membership from “Forensic Artists International”. Her home-based art career included graphic design, and teaching recreational drawing and painting classe...
Ngày tải lên: 24/12/2013, 03:15
Tài liệu Controlling the Playback Speed and Direction of a Timeline docx
... evaluated. If action has a value of "ff", an onEnterFrame event handler is attached to the messages_mc instance. This event handler advances the messages_mc timeline to its current frame, ... is accomplished via an onEnterFrame that gets attached to the messages_mc instance. With that in mind, let's look at the conditional statement one section at a time. If the...
Ngày tải lên: 24/12/2013, 07:17