Is a little knowledge dangerous? docx
... studies have revealed that this type of persons is very rare. So it is always good to know something well. Gaining knowledge in a particular field will definitely make one a master in a subject. ... disappointment and disaster. Those with little education and some of a particular age and sects of women are such examples. They will try to read on a variety of subjec...
Ngày tải lên: 21/07/2014, 20:20
... build dykes against the overflow, who is a naturalist, a geologist, a humanitarian, a diver and a strong swimmer. I love my Bowery. It was my cradle and is my inspiration. I have published one ... experience certainly warrants the supposition that I have at least a passing acquaintance with a few phases of Bowery life. I will be pleased to place whatever knowledge and...
Ngày tải lên: 15/12/2013, 12:15
... rise in their just majesty and take a righteous vengeance for crimes that the law is slow in punishing. I am an advocate of law and order, but I will say to you that less than six months ago ... I'll turn pale and tremble.' "And he does so; and Policeman Fogarty draws his club and says, 'G'wan wid yez!' and in eight seconds the desperate mob has scatte...
Ngày tải lên: 24/12/2013, 18:15
Tài liệu A Little Princess by Frances Hodgson Burnett docx
... quite exhausted by excitement and contradictory stories. A new pupil with a carriage and a pony and a maid, and a voyage from India to discuss, was not an ordinary acquaintance. "My name's ... course papa, this is Emily." So Emily was bought and actually taken to a children's outfitter's shop and measured for a wardrobe as grand as Sara's own. She...
Ngày tải lên: 23/01/2014, 04:20
Tài liệu Báo cáo khoa học: The Arabidopsis protein kinase Pto-interacting 1-4 is a common target of the oxidative signal-inducible 1 and mitogen-activated protein kinases docx
... 5-ACATTGT GCTCAGTGGTGGA-3 and 5-CTGAGGGAAGCAAG AATGGA-3, OXI1 (At3g25250): 5-GACGAGATTATC AGATTTTACGC-3 and 5-AACTGGTGAAGCGGAAG AGAC-3, PTI1-4 (At2g47060): 5-CCCCAAAGAAAATG AGTTGCT-3 and 5-GCATCATTTCCTGGAGGAAAG-3. Acknowledgement This ... SJ, Ward ER, Ryals JA & Dangl JL (1994) Arabidopsis mutants simulating disease resistance response. Cell 77, 565–577. 26 Takahashi A, Agrawal GK, Yamaz...
Ngày tải lên: 14/02/2014, 19:20
Tài liệu Báo cáo khoa học: Activated Rac1, but not the tumorigenic variant Rac1b, is ubiquitinated on Lys 147 through a JNK-regulated process docx
... polyubiquitination and subsequent proteasomal degradation in HEK293 cells, Rac1b is poorly ubiquitinated and appears to be much more resistant to proteasomal degradation than Rac1L61. Mutational analysis ... related to a defective mem- brane interaction. While being persistently activated and associated with plasma membrane, Rac1b has an impaired ability to activate several Rac1 downstrea...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo khoa học: Human enhancer of rudimentary is a molecular partner of PDIP46/SKAR, a protein interacting with DNA polymerase d and S6K1 and regulating cell growth docx
... AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT pEGFP-N1 ⁄ PDIP46(2) ⁄ SKAR(b) AAACTGCAGGATGGCGGACATCTCCCTGGAC AAACTGCAGAAGCTTGATTTTGAATTCTGT pEGFP-N1 ⁄ MEK1 GCGAAGCTTCACGATGCCCAAGAAGAAGCCGACGCC GCGGGATCCCGGATGCTGGCAGCGTGGGTTGG pYESTrp2 ... GCGGGATCCAACAAGGAAGAACCCCCC ATAAGAATGCGGCCGCTCAAAGCTTGATTTTGAATTCTG pEGFP-N1 ⁄ ER GCGAAGCTTCACGATGTCTCACACCATTT GCGGGATCCCGTTTCCCAGCCTGTTGG...
Ngày tải lên: 19/02/2014, 05:20
Tài liệu Báo cáo khoa học: "Dialog Navigator : A Spoken Dialog Q-A System based on Large Text Knowledge Base" docx
... Text Knowledge Base Yoji Kiyota, Sadao Kurohashi (The University of Tokyo) kiyota,kuro @kc.t.u-tokyo.ac.jp Teruhisa Misu, Kazunori Komatani, Tatsuya Kawahara (Kyoto University) misu,komatani,kawahara ... 5 Figure 2: Score calculation. vague concrete Error ga hassei shita. ‘An error has occurred.’ Komatte imasu. ‘I have a problem.’ Windows 98 de kidouji ni error ga hassei shita. ‘An error...
Ngày tải lên: 20/02/2014, 16:20
Tài liệu What is a high school worth?: A model of Australian private secondary school fees docx
... Curriculum and assessment Authority (VCAA) manages and awards school qualifications. It administers and awards two senior school secondary qualifications known as the Victorian Certificate of education ... and students with a language background other than English. The average ICSEA value is 1000 and the lower the value the more disadvantaged is the school. Table 5: Comparisons acro...
Ngày tải lên: 20/02/2014, 19:20
Tài liệu Báo cáo khoa học: The single tryptophan of the PsbQ protein of photosystem II is at the end of a 4-a-helical bundle domain docx
... not mark any as poor or inappropriate. Another structural analysis, obtained by the VERIFY 3 D program [61], gave an average value of 0.21, which is greater than zero, the quality value indicated ... r a Þ where r n and r u are the experimentally determined numerical values of the ratio a/ b, and r a is the theoretical numerical value of ratio a/ b for a mixture of aromatic amino...
Ngày tải lên: 21/02/2014, 00:20