ASTM A 36 SPECIFICATION FOR CARBON STRUCTURAL STEEL SA-36 /SA-36M doc

Ngày tải lên: 10/07/2014, 23:20

... for Computational Linguistics Archivus: A multimodal system for multimedia meeting browsing and retrieval Marita Ailomaa, Miroslav Melichar, Martin Rajman Artificial Intelligence Laboratory ´ Ecole ... certain modalities has an im- pact on how they choose to use language when all modalities are available. On the backend, the wizards can also to some extent have an active role in encourag...

Ngày tải lên: 20/02/2014, 12:20

... states that repairs are available for semantic analysis but provides no details on the representation to be used. Clearly repairs should be available for se- mantic analysis as they play a ... work has proved adequate for a collection of human-human task-oriented dialogs, both in a full manual examination of the corpus, and in tests with a parser capable of parsing some...

Ngày tải lên: 20/02/2014, 19:20

... Annual Meeting of the Association for Computational Linguistics, pages 188-195. Ferreira da Silva, J. and G. Pereira Lopes (1999). A local maxima method and a fair dispersion normalization for ... mutual rank ratio, is a nonparametric rank-based approach which appears to perform significantly better than the standard association metrics. The body of the paper is organized a...

Ngày tải lên: 08/03/2014, 04:22

... 4 Information Structure and Tactical Constraints Entries in the eategorial lexicon have tactical con- straints, grammatical and semantic features, and phonological representation. Similar ... Multi-dimensional compo- sitional functions as a basis for grammatical anal- ysis. In R. T. Oehrle, E. Bach, and D. Wheeler, editors, Categorial Grammars and Natural Lan- guage Structures, D...

Ngày tải lên: 08/03/2014, 07:20

... (DOE) and the National Aeronautics and Space Administration (NASA) can play an im- portant role by sharing their specialized knowledge in this area with others working in less specialized areas ... Echelon Corporation; John Hines, National Aero- nautics and Space Administration; Rodger Lea, Sony Distributed Systems Laboratory; K. Venkatesh Prasad, Ford Research Laboratory; Jonathan Smith, Uni...

Ngày tải lên: 15/03/2014, 15:20

... M ` arquez. 2010b. Linguistic Measures for Automatic Machine Translation Evalua- tion. Machine Translation, 24(3–4):77–86. Ahmed El Kholy and Nizar Habash. 2011. Automatic Error Analysis for ... presents an application that shows how a set of heterogeneous automatic metrics can be used to evaluate a test bed of automatic translations. To do so, we have set up an online graphical inter...

Ngày tải lên: 16/03/2014, 20:20

... that directly upstream of P HOP2 (5¢-ATACAATTAATTGACATCAGCAGACAGCAAAT GCACTTGATATACGCAGCTCGACTACGTCGTAAG GCCG-3¢ and 5¢ -ATCTTTCAAATAGAGCCTGG-3¢). The amplified DNA fragments were used to transform BFG2Z18-K3 5A, ... 5¢-AAATATAAAACGCTAGCGTCGACATGGC GC-3¢ and 5¢-AGCGTAAAGGATGGGGAAAG-3 ¢. The final ratio of target cells was determined by the number of colonies retaining the target gene divided by...

Ngày tải lên: 22/03/2014, 21:20

... OCIF leading to closed-form formula for the global outage probability and for the spatial outage probability. At last, this approach allows us to quantify cell breathing and network densification. References [1 ]A. M.ViterbiandA.J.Viterbi,“Erlangcapacityofapower controlled ... this formula, we are able to obtain the global outage probability as well as the spatial outage probability, which...

Ngày tải lên: 21/06/2014, 11:20