FUN WITH A PENCIL pot
FUN WITH A PENCIL pot
... plan would be too complicated to draw. For instance, the top of the head, or cranium, is nearer to a ball in shape than anything else. So we start with a bull, and add to it the shapes we want. ... the lack of any method of approach having any marked degree of accu- racy. I was told to draw the head as an egg or oval, and to proceed from there. Fine for a straight front view. But what...
Ngày tải lên: 04/07/2014, 11:20
Drawing - Fun With A Pencil
... is valuable in caricature. You can trace a photo, and draw from the tracing, or take any of your own drawings and dis- tort them. Here again is a chance for your own invention. Draw a square around ... not start with a form anything like the skull, or make any allowance for the variety of shapes. After this book was pub- lished, I learned with inter- est that a similar basic hea...
Ngày tải lên: 13/09/2012, 14:19
Báo cáo y học: " Vgf is a novel biomarker associated with muscle weakness in amyotrophic lateral sclerosis (ALS), with a potential role in disease pathogenesis"
... Zhao Z, Lange DJ, Voustianiouk A, Macgrogan D, Ho L, Suh J, Humala N, Thiyagarajan M, Wang J, Pasinetti GM. A ketogenic diet as a potential novel therapeutic intervention in amyotrophic lateral ... incubation with a reporter antibody (HRP–conjugated anti–rabbit IgG, Santa Cruz Biotech, CA). The assay was developed using a stabilized HRP substrate. All samples were analyzed in...
Ngày tải lên: 03/11/2012, 10:52
Báo cáo khoa học: Serine-arginine protein kinases: a small protein kinase family with a large cellular presence potx
... (Sky1 and Dsk1, respectively); Candida albicans with two (QSAA48 and QS9Q27); Aspergilus niger with nine (A2 QAE4, A2 QB94, A2 QC46, A5 AB23, A2 QWQ2, A2 QX01, A2 QX98, A2 R2M0 and A2 RSV1)]; plants with ... and 1a is nega- tively affected by interaction with scaffold attachment factors B1 and 2. FEBS J 276, 5212–5227. 18 Nakagawa O, Arnold M, Nakagawa M, Hamada H, Shelton J...
Ngày tải lên: 06/03/2014, 01:20
Báo cáo khoa học: Enhancing the protein production levels in Escherichia coli with a strong promoter potx
... ACACCC- ATGGAGCTTTCCTGTGTGAAATTGT, lacUV5 was amplified. TEHA3: ACACAGATCTCTGCAGTGAAATG- AGCTGTTGACAATTA and TEHA4: ACACCCATGGT- CTGTTTCCTGTG were used for trc amplification. The exact nucleotide sequence of each promoter region ... promoters lacUV5 and trc were amplified by PCR from vectors including the relevant genes. By using primers TEHA1: ACACAGATCTCTGCA- GGGCACCCCAGGCTTTACA and TEHA2: ACA...
Ngày tải lên: 06/03/2014, 01:20
PUBLIC PERCEPTIONS OF URBAN AIR POLLUTION WITH A FOCUS ON DEVELOPING COUNTRIES potx
... Research Program at the East-West Center. He is also Affiliate Faculty at the Department of Urban And Regional Planning, University of Hawai`i at Manoa. He has a Ph.D. in Environmental Science and ... Colorado Keown C F. 1989 Risk Perceptions of Hong Kongese vs. Americans Risk Analysis 9(3): 401-405 Koushki P A, Al-Fadhala S, Al-Saleh O, and Aljassar A H. 2002 Urban air pollutio...
Ngày tải lên: 06/03/2014, 16:20
Báo cáo khoa học: The crystal structure of NlpI A prokaryotic tetratricopeptide repeat protein with a globular fold potx
... Core Facility (Yale University, New Haven, CT, USA). Primers to amplify mature NlpI (residues 20–294) were 5¢-aataatccatggggagtaatacttcctggcgta aaagtgaagtcc-3¢ and 5¢-attattggatccctattgctggtccgattctgccag-3¢. 3-TPR ... preceding AB pair (Fig. 1A) . Local AB, BA¢ and nonlocal AA¢ helix packing generate an extended superhelical array with right-handed twist. The motif is often terminated by an...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo Y học: Solution structure of the Alzheimer amyloid b-peptide (1–42) in an apolar microenvironment Similarity with a virus fusion domain potx
... 293–298. 15. Bhattacharjya, S., Venkatraman, J., Kumar, A. & Balaram, P. (1999) Fluoroalcohols as structure modifiers in peptides and proteins: hexafluoroacetone hydrate stabilizes a helical conformation ... melittin at low pH. J. Peptide Res. 54, 100–111. 16. Rajan, R., Awasthi, S.K., Bhattachajya, S. & Balaram, P. (1997) ÔTeflon-coated peptidesÕ: hexafluoroacetone trihydrate as a s...
Ngày tải lên: 08/03/2014, 09:20
Báo cáo khoa học: "Enhancing a large scale dictionary with a two-level system" potx
Ngày tải lên: 09/03/2014, 01:20
Reproductive System Structure, Development and Function in Cephalopods with a New General Scale for Maturity Stages pot
... of nucleoli appearance and disappearance. Nucleoli are not distinguishable before simple follicle formation in Octopoteuthis sicula, Sepia bertheloti and Abraliopsis atlantica. In Argonauta argo and Pteriqioteutnis gemmata, at ... Development and Function in Cephalopods 71 TABLE 1. A general scale of maturity stages for male and female cephalopods. (AG = accessory glands, oviducal glands, N...
Ngày tải lên: 14/03/2014, 16:20