Báo cáo khoa học : Understanding a Widely Misunderstood Statistic: Cronbach’s α pptx

... transmembrane serine protease, is inhibited by hepatocyte growth factor activator inhibitor type 1 and activates pro -hepatocyte growth factor Tomio Hashimoto 1 , Minoru Kato 2 , Takeshi Shimomura 2 and Naomi ... factor activator inhibitor type 1; HAI-2, hepatocyte growth factor activator inhibitor type 2; HGF, hepatocyte growth...

Ngày tải lên: 15/02/2014, 01:20

... nonribosomal peptide synthetases: the emerging view from bacterial genomics. Nat Prod Rep 24, 107 3–1 109. 32 Umezawa H, Aoyagi T, Ogawa K, Obata T, Iinuma H, Naganawa H, Hamada M & Takeuchi T (1985) ... on an analytical scale. The sensitivity of radioactivity detection and sophisti- cated analytical separation proved to be advantageous in this approach. The iron-chelating pro...

Ngày tải lên: 16/02/2014, 09:20

... compilation ª 2009 FEBS TransLISA, a novel quantitative, nonradioactive assay for transcription factor DNA-binding analyses Kristiina A. Vuori 1 , Johanna K. Ahlskog 2 , Lea Sistonen 2 and Mikko ... antisense AGCTGATCTTCGAAGATCTTCGAAGAT Mutated HSE sense Biotin-TCGACTT CAAGCTTGTACAAGCTTGTAG Mutated HSE antisense AGCTGAAGTTCGAACATGTTCGAACATC ‘Scrambled’ oligonucleotide B...

Ngày tải lên: 18/02/2014, 14:20

... Journal compilation ª 2007 FEBS 4207 Understanding the binding properties of an unusual metal -binding protein ) a study of bacterial frataxin Chiara Pastore 1 , Marisa Franzese 2 , Filomena Sica 2,3 , ... A ˚ and 2.6 A ˚ ) and Glu19 (2.7 A ˚ ), and two water molecules (1.7 A ˚ and 1.9 A ˚ ) (Fig. 4E). In M5, the side chains of Asp76 (1....

Ngày tải lên: 18/02/2014, 16:20

... 5 Summary and Outlook Discourse markers, words that signal the pres- ence of a coherence relation between adjacent text spans, play important roles in human text understanding and production. ... though. As we have illustrated above and will elaborate below, these words can carry a wide variety of semantic and pragmatic overtones, which render the choice of a...

Ngày tải lên: 20/02/2014, 18:20

... that when they are formulated loosely, as in the pre- vious paragraph, they appear to conflict. In par- ticular, in ( 2a) , Right Association seems to call for the parse that makes for Mary a ... this paper describes the lexicon, grammar, and semantics of English, Gemini has also been used in a Japanese spo- ken language understanding system (Kameyama, 1992). 2.1. Grammar...

Ngày tải lên: 20/02/2014, 21:20

... Model for Mixed-Initiative Dialogues This paper presents an enhanced model of plan-based dialogue understanding. Most plan-based dialogue understanding models derived from [Litman and Allen, ... SURFACE-RE~UEST(SpB,SpA, I2) Plan-5 ID-PARAM(SpA, SpB,have(form),GF,Plan3) I I2: INFORMIF(SpA, SpB,have(form)) Plan2 [Completed] ID-PARAM(SpB, SpA, proc,AC,Plan3) II: INFORNR...

Ngày tải lên: 23/03/2014, 20:20

... meaning that can be efficiently encoded in a dynamic pragmatic formalism. Acknowledgements The author thanks Barbara Grosz and Julia Hirschberg, who both advised this research, for valuable comments ... comments and guidance; and acknowledges current support from a Na- tional Science Foundation Graduate Fellowship. This paper stems from research carried out at Harvard University...

Ngày tải lên: 23/03/2014, 20:20

... FOR LANGUAGE PLANNING Douglas E. Appelt Artificial Intelligence Center SRI International Menlo Park, California O. Abstract Planning provides the basis for a theory of language generation ... of a language- planning system that efficiently encompasses a significant portion of English. A small grammar has been written that already has more power than the grammar...

Ngày tải lên: 31/03/2014, 17:20

... presented at the annual meeting of the Southwest Educational Research Association, New Orleans, February 18, 2010 CRONBACH’S ALPHA 3 Understanding a Widely Misunderstood Statistic: Cronbach’s α Researchers ... to analyze. Finally, select paste to paste the below syntax into your syntax file and run. RELIABILITY /VARIABLES=X1 X2 X3 /SCALE(ALL VARIABLES) ALL /MODEL=ALPH...

Ngày tải lên: 29/06/2014, 15:20

... information spreads across such a network. One of the basic tenets of a network analysis comprised of individuals, a ‘social network, ’ is that the structure of the network matters. That is, the ... this article as: Parchman et al.: Understanding the implementation of evidence-based care: A structural network approach. Implementation Science 2011 6...

Ngày tải lên: 10/08/2014, 10:23

... RESEARCH Open Access Understanding the context of Balanced Scorecard Implementation: a hospital-based case study in Pakistan Fauziah Rabbani 1,8* , Sabrina NH Lalji 1 , Farhat Abbas 2 , SM Wasim ... territoriality to altruism in interprofessional collaboration and leadership. Journal of Interprofessional Care 2009, 23:320-330. 37. Inamdar N, Kaplan RS, Bower M: Apply...

Ngày tải lên: 10/08/2014, 10:23

... Access Understanding the relationship between the perceived characteristics of clinical practice guidelines and their uptake: protocol for a realist review Monika Kastner 1* , Elizabeth Estey 1 , Laure Perrier 1,2 , ... Kastner et al.: Understanding the relationship between the perceived characteristics of clinical practice guidelines and...

Ngày tải lên: 10/08/2014, 11:20

... Fortis International, an Indian health care company, interested in international expansion. Within weeks, Khazanah Nasional Berhad, the Malaysian government investment arm, and existing Parkway shareholder, ... ISS, was already involved in global facilities management business in the public and private sectors. This multinational company had set up a health care division as a...

Ngày tải lên: 11/08/2014, 14:21