ICENI: Optimisation of Component Applications within a Grid Environment pot
ICENI: Optimisation of Component Applications within a Grid Environment pot
... CommunityPublicUsersDomainAdministrativeDataResourceResourceComputationalSoftwarePrivate PolicyManagerManagerComputational CommunityPublicMapperApplicationFrameworkActivationBrowserResourceResourceManagerIdentitye.g ... ...
- 21
- 117
- 0
SOLVING THE PROBLEM OF CHILDHOOD OBESITY WITHIN A GENERATION potx
... nutritional standards based on the Dietary Guidelines and appeal to children. Food manufacturers and marketers have a critical role to play in meeting new stan-dards, and have already shown an ability ... recently-enacted Patient Protection and A ordable Care Act, as amended by the Health Care and Education A ordability Reconciliation Act (collectively referred to as the A ordable Care Act”) provides ... similar law prior to enactment of the A ordable Care Act, and early research indicates it may have favorably a ected eating habits, although rm conclusions cannot yet be drawn.122 A recent...
- 124
- 1,038
- 0
Báo cáo hóa học: " Predicting the subcellular localization of viral proteins within a mammalian host cell" doc
... can accurately predict theintracellular localization of viral proteins in human cells.Our viral subcellular localization predictions are availableas additional files.ResultsEukaryotic targeting ... UL33 and US27in endocytic compartments and viral membranes. Traffic2002, 3:218-232.69. Ogawa-Goto K, Irie S, Omori A, Miura Y, Katano H, Hasegawa H,Kurata T, Sata T, Arao Y: An endoplasmic ... prediction dataset is available as supplementarymaterial, please see Additional file 2). The predictionaccuracy of PSLT on this dataset is estimated to be 60%according to the literature. Almost all...
- 8
- 302
- 0
Báo cáo hóa học: " Characterization of diverse natural variants of CYP102A1 found within a species of Bacillus megaterium" potx
... primers and B. megaterium chro-mosomal DNA template. First, PCR was carried out in a 50 μl reaction mixture containing template plasmid, for-ward primer BamHI-F (5’- AGCGGATCCATGACAAT-TAAAGAAATGCCTC-3’) ... 52°C, and 90 s of extension at 72°C. Next, PCR wascarried out in a similar way by use of forward primerSacI-F (5’ -ATACAAACTACGAGCTCGAT-3’ )andreverse primer XhoI-R (5’ -ATCCTCGAGTTACC-CAGCCCACACGTC-3’). ... 1).Biochemical characterization of the natural variantsThe biochemical properties of the variants were exam-ined. All CYP10 2A1 variants could bind to satu ratedfatty acids in the range of 12-16 carbons...
- 12
- 354
- 0
A Review of Approaches to Mobility Telemonitoring of the Elderly in Their Living Environment potx
... sys-tem must be accurate, reliable, and have continuous ac-cess to an alarm center. An inaccurate system which raisesfalse alarms wastes valuable healthcare resources; can leadto a lack of confidence ... Wearable data forwarding systems, the lightestwearable option, are suited to the frail and housebound asthey analyze the data in real-time and can raise immediatealerts. Data-logging wearables ... real-time feedback to a user and do not require large amounts of data storage, as the raw data are typically summarized inreal-time before storage or transmission. The use of sum-marized data also reduces...
- 17
- 603
- 1
The Treatment of Uncertainty in EPA’s Analysis of Air Pollution Rules: A Status Report pot
... of Air Quality Planning and Standards. www.epa.gov/ttn/ecas/regdata/RIAs/finalpbria.pdf. ———. 200 9a. Proposed NO2 NAAQS Regulatory Impact Analysis (RIA). Research Triangle Park, NC: Office ... Regulatory Impact Analysis, March 2008. National Ambient Air Quality Standards for Ground-level Ozone, Chapter 6. Research Triangle Park, NC: Office of Air Quality Planning and Standards. www.epa.gov/ttn/ecas/regdata/RIAs/6-ozoneriachapter6.pdf ... Treatment of Uncertainty in EPA’s Analysis of Air Pollution Rules: A Status Report Arthur G. Fraas Abstract An understanding of the uncertainty in benefit and cost estimates is a critical part...
- 24
- 427
- 0
Báo cáo khoa học: "Unsupervised Learning of Arabic Stemming using a Parallel Corpus" pot
... is a language-independent algo-rithm.English Phrase: the advisory committeeArabic Phrase: Alljnp AlAst$ArypTask: stem AlAst$ArypChoices ScoreAlAst$Aryp 0.2AlAst$Aryp 0.7AlAst$Aryp ... 1999).Usually, entire documents are translated by humans,and the sentence pairs are subsequently aligned byautomatic means. A small parallel corpus can beavailable when native speakers and translators ... text.1.1 Arabic detailsIn this paper, Arabic was the target language but theapproach is applicable to any language that needsaffix removal. In Arabic, unlike English, both pre-fixes and suffixes...
- 8
- 424
- 0
Within A Budding Grove potx
... at all disapprove of your idea of taking up writing,’ my father had reported. And as he had a certain amount of inuence himself, he imagined that there was nothing that could not be ‘arranged,’ ... not in a position to make compari-sons, and would have been greatly surprised to learn that he was not at all a rude man by nature. Complete impas-sivity was what he strove to attain, and even ... he had been Minister Plenipotentiary before the War, and was actually an Ambassador on the Sixteenth of May; in spite of which, and to the general astonishment, he had since been several times...
- 783
- 500
- 0
Guy Fawkes or A Complete History Of The Gunpowder Treason, A.D. 1605 pot
... saw a man standing in a corner of the cellar, who stated that he was Percy'sservant, and that he was left by his master in charge of the house and cellar. This individual was Guy Fawkes,who ... a treatise licensed by Garnet and Blackwall. Certain instances are given in the workas illustrations of the doctrine. The following is one of these cases. A man arrives at a certain place, and ... and was the means of suspending theoperations of the conspirators for a season. As soon as James's accession was known, the king of Spainendeavoured to enter into a negociation for peace,...
- 74
- 422
- 0
Báo cáo Y học: Two independent, light-sensing two-component systems in a filamentous cyanobacterium pot
... ACCCGGGTCGACTCAGTGATGGTGGTGATGGTGTCCTCGACCAAAAAGATC; rcpA:forward,GCGATAGAATTCATGAGCGTAGAAACGGAAGAC and reverse, CGAAGCTTGTCGACTCAGTGATGGTGGTGATGGTGCTCCGACGGCAATGTCG; cphB:forward,GCGATAGAATTCATG ... cphB:forward,GCGATAGAATTCATG ACGAATTGCGATCGCGA and reverse, ACCCGGGTCGACTCAGTGATGGTGGTGATGGTGTTTGACCTCCTGCAATGT; cphBlong:forward,GCGATAGAATTCATGTTGCAGTTAATTTATAACAATT; the reverseprimer was identical to that used ... principally allowing covalent chromophore binding.Forward primer: 5¢-CACTCGGTACTCCGCAGCGTTTCGCCGTGTCACATTGAATATTTGCACAATATGG-3¢; reverse primer: 5¢-CCATATTGTGCAAATATTCAATGTGACACGGCGAAACGCTGCGGAGTACCGAGTG-3¢....
- 10
- 499
- 0
Từ khóa: Nghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngchuyên đề điện xoay chiều theo dạngMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ