ICENI: Optimisation of Component Applications within a Grid Environment pot
... Community Public Users Domain Administrative Data Resource Resource Computational Software Private Policy Manager Manager Computational Community Public Mapper Application Framework Activation Browser Resource Resource Manager Identity e.g ...
Ngày tải lên: 29/06/2014, 04:20
... nutritional standards based on the Dietary Guidelines and appeal to children. Food manufacturers and marketers have a critical role to play in meeting new stan- dards, and have already shown an ability ... recently-enacted Patient Protection and A ordable Care Act, as amended by the Health Care and Education A ordability Reconciliation Act (collectively referred to as the A ordable Car...
Ngày tải lên: 14/03/2014, 09:20
... can accurately predict the intracellular localization of viral proteins in human cells. Our viral subcellular localization predictions are available as additional files. Results Eukaryotic targeting ... UL33 and US27 in endocytic compartments and viral membranes. Traffic 2002, 3:218-232. 69. Ogawa-Goto K, Irie S, Omori A, Miura Y, Katano H, Hasegawa H, Kurata T, Sata T, Arao Y: An endoplas...
Ngày tải lên: 20/06/2014, 01:20
Báo cáo hóa học: " Characterization of diverse natural variants of CYP102A1 found within a species of Bacillus megaterium" potx
... primers and B. megaterium chro- mosomal DNA template. First, PCR was carried out in a 50 μl reaction mixture containing template plasmid, for- ward primer BamHI-F (5’- AGCGGATCCATGACAAT- TAAAGAAATGCCTC-3’) ... 52°C, and 90 s of extension at 72°C. Next, PCR was carried out in a similar way by use of forward primer SacI-F (5’ -ATACAAACTACGAGCTCGAT-3’ )and reverse primer XhoI-R (5’ -ATCC...
Ngày tải lên: 21/06/2014, 05:20
A Review of Approaches to Mobility Telemonitoring of the Elderly in Their Living Environment potx
... sys- tem must be accurate, reliable, and have continuous ac- cess to an alarm center. An inaccurate system which raises false alarms wastes valuable healthcare resources; can lead to a lack of confidence ... Wearable data forwarding systems, the lightest wearable option, are suited to the frail and housebound as they analyze the data in real-time and can raise immediate alerts. Data-loggin...
Ngày tải lên: 05/03/2014, 21:20
The Treatment of Uncertainty in EPA’s Analysis of Air Pollution Rules: A Status Report pot
... of Air Quality Planning and Standards. www.epa.gov/ttn/ecas/regdata/RIAs/finalpbria.pdf. ———. 200 9a. Proposed NO 2 NAAQS Regulatory Impact Analysis (RIA). Research Triangle Park, NC: Office ... Regulatory Impact Analysis, March 2008. National Ambient Air Quality Standards for Ground-level Ozone, Chapter 6. Research Triangle Park, NC: Office of Air Quality Planning and Standards. ww...
Ngày tải lên: 06/03/2014, 19:20
Báo cáo khoa học: "Unsupervised Learning of Arabic Stemming using a Parallel Corpus" pot
... is a language-independent algo- rithm. English Phrase: the advisory committee Arabic Phrase: Alljnp AlAst $ Aryp Task: stem AlAst $ Aryp Choices Score AlAst$Aryp 0.2 AlAst$Aryp 0.7 AlAst$Aryp ... 1999). Usually, entire documents are translated by humans, and the sentence pairs are subsequently aligned by automatic means. A small parallel corpus can be available when native speakers and tr...
Ngày tải lên: 08/03/2014, 04:22
Within A Budding Grove potx
... at all disapprove of your idea of taking up writing,’ my father had reported. And as he had a certain amount of inuence himself, he imagined that there was nothing that could not be ‘arranged,’ ... not in a position to make compari- sons, and would have been greatly surprised to learn that he was not at all a rude man by nature. Complete impas- sivity was what he strove to at...
Ngày tải lên: 08/03/2014, 15:20
Guy Fawkes or A Complete History Of The Gunpowder Treason, A.D. 1605 pot
... saw a man standing in a corner of the cellar, who stated that he was Percy's servant, and that he was left by his master in charge of the house and cellar. This individual was Guy Fawkes, who ... a treatise licensed by Garnet and Blackwall. Certain instances are given in the work as illustrations of the doctrine. The following is one of these cases. A man arrives at a c...
Ngày tải lên: 08/03/2014, 22:20
Báo cáo Y học: Two independent, light-sensing two-component systems in a filamentous cyanobacterium pot
... ACCCGG GTCG ACTCAGTGATGGTGGTGATGGTGTCCTCGACC AAAAAGATC; rcpA:forward,GCGATA GAATTCATG AGCGTAGAAACGGAAGAC and reverse, CGAAGCTT GTCGACTCAGTGATGGTGGTGATGGTGCTCCG ACGGCAATGTCG; cphB:forward,GCGATA GAATTC ATG ... cphB:forward,GCGATA GAATTC ATG ACGAATTGCGATCGCGA and reverse, ACCCGG GTCGACTCAGTGATGGTGGTGATGGTGTTTGAC CTCCTGCAATGT; cphBlong:forward,GCGATA GAA TTCATGTTGCAGTTAATTTATAACAATT; the reverse...
Ngày tải lên: 08/03/2014, 23:20