Small Group Behaviour in a Virtual and Real Environment: A Comparative Study pptx

... compared between the virtual and real. After the real meeting each participant was assigned approximately the same leadership rating, whereas immediately after the virtual meeting Red emerged as the ... an artificial agent also embodied as an avatar. Generally agents (the humans, virtual humans and other virtual beings such as birds) are able to generate sound, and move as ex...

Ngày tải lên: 28/06/2014, 23:20

... fine fibers and some 23 RAW MATERIAL PREPARATION Depithing Solid Waste PULP MAKING Gas emission Digestion Black Liquor Washing Wastewater PAPER MAKING Beating Wastewater Dilution Paper Machine ... operational and maintenance practices and others. On the other hand agricultural residues are especially suitable for small scale mills as their raw materials. However, using agricultural...

Ngày tải lên: 09/03/2014, 01:20

... timber usage and fashion changes.  Sovereign risk: regulatory changes, taxation changes, uncertain harvest rights. 4 Key Parameters in Forestry Models  Establishment:- land, land preparation, ... preparation, plant stock, planting, watering.  Maintenance:- weed control, fertilizing, pruning and thinning, fire and pest protection.  Inflows:- wood; commercial thinning, fin...

Ngày tải lên: 23/03/2014, 04:20

... the N-terminal fragment of the poneratoxin gene. Two others: forward 5¢-GCC GCCCGTGATACAGGCGATCCACGATGCGCAGA GGTAGTAATGAG-3¢ and reverse 5¢-AATTCTCATTA CTACCTCTGCGCATCGTGGATCGCCTGTATCAC GGG-3¢ ... construction of the poneratoxin gene [11]. Two oligonucleotides: forward 5¢- 2 GATCCATGTTTCTTCCGCTTCTGATCCTTGGCT CTCTTCTGATGAC-3¢ and reverse 5¢-CGGCGTCATCA GAAGAGAGCCAAGGATCAGAAGCGGAAGAAA CATG-...

Ngày tải lên: 30/03/2014, 13:20

... trPRAI-His The far-UV and near-UV CD spectra of trPRAI-His were recorded and analyzed in a manner identical with those for PRAI and FLAG-PRAI (vide supra). In addi- tion, the thermal melting ... became apparent that the latter displayed increased binding at any given concentration (Fig. 6). Affinities for the antibody were quantified by analyzing binding data at five concentrations o...

Ngày tải lên: 30/03/2014, 20:20

... asking personal details, problems and wants, 3) giving information about accommodation, tourist information, transportation, and emergency calls, 4) giving direction, and 5) giving advice and ... Buripakdi, C. and Mahakhan, P. (1980). Thailand. In T.N. Postlethwaite, and R. M. Thoman (Ed.), Schooling in the ASEAN Region. London: Pergamon Press. Canale, M. and Swain, M....

Ngày tải lên: 02/04/2014, 05:20

... your marketing people to create effective messaging in attractive packaging. ” She winked at Ryan and subtly smoothed her shirt against her side. “ Clothing, as we like to call it. ” Ryan laughed. ... I actually chalk it up to our sales and marketing approach. I think that ’ s what ’ s kept us going and growing all these years, through both good and bad economic times. ” Now...

Ngày tải lên: 07/04/2014, 11:11

Ngày tải lên: 03/06/2014, 01:10

... time as a percen- tage of the movement duration (%Dur). Joint angle mathematical characterization and accuracy After data normalization, each joint angula r profile was mathem atically characterized ... 2011) RESEARCH Open Access Multi-finger coordination in healthy subjects and stroke patients: a mathematical modelling approach Ilaria Carpinella 1* , Johanna Jonsdottir 2 and Maur...

Ngày tải lên: 19/06/2014, 08:20

... combined anomaly. The average age of the patients was 15.2 years (ranged 10– 20). The average coronal Cobb angle of the main curve was 95.7° (range 70°–150°) and the average thoracic kyphosis was ... average original curve measured 112° and reduced to 58° after final correction. Four patients got pin-site irritation and the pins were reinserted. Paresthesia developed in 3 patients, a...

Ngày tải lên: 20/06/2014, 01:20