... currently writes a Ruby and Rails blog at http://rakeroutes.com and a CoffeeScript blog at http://coffeescriptcafe.com. He lives with his wife, Sarah, and two children, Edward and Marie, in Durham, ... without its many warts. www.it-ebooks.info Table of Contents [ iv ] Chapter 5: CoffeeScript and Node.js 95 Node is event-driven 95 Node is fast and scalable 96 Node is not R...
Ngày tải lên: 06/03/2014, 20:21
... xxvftoc.indd xxv 21/09/12 6:42 PM21/09/12 6:42 PM www.it-ebooks.info PROFESSIONAL Node.js ® BUILDING JAVASCRIPT BASED SCALABLE SOFTWARE Pedro Teixeira ffirs.indd vffirs.indd v 22/09/12 10:16 AM22/09/12 ... xiffirs.indd xi 22/09/12 10:16 AM22/09/12 10:16 AM www.it-ebooks.info Professional Node.js®: Building JavaScript- Based Scalable Software Published by John Wiley &...
Ngày tải lên: 08/03/2014, 10:20
Guidelines for Use of Personal Protective Equipment by Law Enforcement Personnel During A Terrorist Chemical Agent Incident potx
... INTRODUCTION AND BACKGROUND The challenges facing law enforcement officers vary greatly between those of a hazardous materials (HAZMAT) incident and a deliberate attack using chemical agents. ... activities that they would perform in an actual chemical response. MIST does not place people at risk of exposure to chemical agents because a chemical simulant vapor...
Ngày tải lên: 17/03/2014, 14:20
Agent-based and analytical modeling to evaluate the effectiveness of greenbelts potx
... outcomes The outcomes of ABM 1D were evaluated by run- ning the model until the total number of agents equals the total number of cells to the left of the greenbelt. This is equivalent to the constraint ... have to align them- selves with the ridges of the aesthetic quality surface and, with the help of the new service centers, develop along the top...
Ngày tải lên: 23/03/2014, 13:20
JUMP START NODE.JS potx
... callback function. Otherwise, we send back the actual user object. Jump Start Node.js (www.sitepoint.com) Jump Start Node.js1 4 JUMP START NODE.JS BY DON NGUYEN Password Security In this example, we ... form ■ storing data in MongoDB using the cloud platform from MongoLab Jump Start Node.js (www.sitepoint.com) Jump Start Node.js1 6 I share. Node.js is a joy to wo...
Ngày tải lên: 31/03/2014, 19:20
Ext JS 4 First Look potx
... Ext JS 4 class system • Ext JS 4 SDK • Ext JS 3 versus Ext JS 4 compatibility • Migrating from Ext JS 3 to Ext JS 4 • A quick overview of new components Getting started with Ext JS 4 Ext JS ... 229 Validation 2 34 Form label 238 Actions 238 Summary 240 Chapter 6: Ext JS 4 Themes 241 Getting started with Ext JS 4 themes 241 Installi...
Ngày tải lên: 01/04/2014, 15:20
Báo cáo sinh học: "Glycyrrhizin as antiviral agent against Hepatitis C Virus" potx
... Forward: ACCACAGTCCATGCCATCAC: and GAPDH reverse; TCCACCACCCTGTTGCTGTA PCR was performed by initial denaturation at 95 C for 5 min followed by 30 cycles, each of denaturation at 92 C for 45s, ... formula was used to calculate the c oncentra- tion HCV RNA of each sample. Cy3STD/Res Fam. STD / Res × coefficient IC = IU HCV/m L IC = internal control, which is specific for each lot. Antiviral...
Ngày tải lên: 18/06/2014, 22:20
Báo cáo hóa học: " Biocompatible Nanocomplexes for Molecular Targeted MRI Contrast Agent" potx
... nano- technology to obtain the nanocomplexes as contrast agent for molecular MRI. The formulation was tested for physi- cal parameters such as particle size, zeta potential, image contrast effect, and ... NANO EXPRESS Biocompatible Nanocomplexes for Molecular Targeted MRI Contrast Agent Zhijin Chen Æ Dexin Yu Æ Shaojie Wang Æ Na Zhang Æ Chunhong ... image contrast...
Ngày tải lên: 22/06/2014, 00:20
Luận văn:" KIẾN TRÚC PHẦN MỀM DỰA TRÊN AGENT" potx
... kiến trúc phần mềm dựa trên Agent 6 1.2 Bài toán xây dựng mô hình phân tải mạng nhờ Proxy động dựa trên Agent 7 1.3 Nội dung và cấu trúc khóa luận 7 Chương 2. TỔNG QUAN VỀ AGENT 9 2.1 Agent phần ... kiến trúc xếp gộp [8], cho đến các kiến trúc phức tạp hơn như là kiến trúc dựa trên sự tin tưởng vào mục đích (BDI-Belief Desire Intention) [9]. Kiến trúc...
Ngày tải lên: 28/06/2014, 00:20
Trojan.Win32.Agent.azsy potx
... dưới đây: %Documents and Settings%\<user_name>\Application Data\svchosts.exe Trojan.Win32.Agent.azsy Data\dumpreport.exe %Documents and Settings%\<user_name>\Application
Ngày tải lên: 28/06/2014, 20:20
Trojan-Downloader.JS.Agent.sg potx
... dữ liệu virus và thực hiện quét toàn bộ máy tính. Trojan-Downloader.JS.Agent.sg
Ngày tải lên: 28/06/2014, 20:20
Báo cáo vật lý: "Protective Agent-Free Synthesis of Colloidal Cobalt Nanoparticles" potx
... Protective Agent-Free Synthesis 4 3. RESULTS AND DISCUSSION 3.1 Formation and Characterization of Colloidal Co Nanoparticles Colloidal Co nanoparticles were prepared by the reduction of Co ... & Jeyadevan, B. (2007). Designed synthesis of cobalt and its alloys by polyol process. J. Solid State Chem., 180, 3008–3018. Protective Agent-Free Synthesis...
Ngày tải lên: 07/08/2014, 14:20
Báo cáo lâm nghiệp: "Contribution à l’étude du couple Fomes annosus-épicéa variabilité de l’hôte et de l’agent pathogène" potx
... Contribution à l’étude du couple Fomes annosus-épicéa : variabilité de l’hôte et de l’agent pathogène : (Contribution to the study of Fomes annosus (Contribution to the study of Fomes ... une grande variabilité du comportement des isolats, particulièrement en ce qui concerne la sécrétion de laccase, et la sensibilité aux terpènes. L...
Ngày tải lên: 09/08/2014, 06:21
Báo cáo khoa học: " Enhancement of radiosensitivity in human glioblastoma cells by the DNA N-mustard alkylating agent BO-1051 through augmented and sustained DNA damage response" potx
... of 13 RESEARCH Open Access Enhancement of radiosensitivity in human glioblastoma cells by the DNA N-mustard alkylating agent BO-1051 through augmented and sustained DNA damage response Pei-Ming ... design DNA- directed alkylating agents by linking the alkylating pharmacophore to the DNA- affinity molecules (e.g., DNA intercalating agent...
Ngày tải lên: 09/08/2014, 09:20
báo cáo khoa học: " Antimicrobial activity of spherical silver nanoparticles prepared using a biocompatible macromolecular capping agent: evidence for induction of a greatly prolonged bacterial lag phase" potx
... biocompatible macromolecular capping agent: evidence for induction of a greatly prolonged bacterial lag phase. Journal of Nanobiotechnology 2010 8:34. Submit your next manuscript to BioMed Central and take ... than S. aureus to the keratin-based Ag Nps. Conclusions In this work we have evaluated the antimicrobial prop- erties of a biocompatible macromolecu...
Ngày tải lên: 11/08/2014, 00:22