Báo cáo khoa học " Structure elucidation and antioxidant activity of a novel polysaccharide isolated from Tricholoma matsutake " ppt

... 2010Accepted 19 April 2010Available online 27 April 2010Keywords: Polysaccharide structure Antioxidant assay Tricholoma matsutake abstractIn this study, structural features of Tricholoma matsutake ... available at ScienceDirectInternational Journal of Biological Macromoleculesjournal homepage: www.elsevier.com/locate/ijbiomac Structure elucidation and antioxidant activity of a novel polysaccharide ... Hydroxyl radical scavenging effect of TMP -A from Tricholoma matsutake. Fig. 6. Superoxide radical scavenging effect of TMP -A from Tricholoma matsutake. Fig. 7. TMP -A attenuated PC12 cell damage induced...

Tài liệu Báo cáo khoa học: Physicochemical characterization and biological activity of a glycoglycerolipid from Mycoplasma fermentans ppt

... 3279Physicochemical characterization and biological activity of a glycoglycerolipid from Mycoplasma fermentansKlaus Brandenburg1, Frauke Wagner1, Mareike Mu¨ ller1, Holger Heine1,Jo¨ rg Andra¨1, ... i.e. agonistically as wellas antagonistically, completely inactive. The lack of antagonistic activity may be explained by the fact thatthis lipid A does not intercalate into target cell membranesby ... Meyer, H.W. &Seydel, U. (1998) Characterization of the nonlamellar cubic and HII structures of lipid A from Salmonella enterica serovar Min-nesota by X-ray diﬀraction and freeze-fracture electron...

Báo cáo khoa học: Identiﬁcation and functional characterization of a novel barnacle cement protein pptx

... TSVSAGDGAFGNLAAALTLVEDTEDGLGVKTKNGGKGFSEGTAAISQTAGANGGATVKKABacp19k VSASAANGFFKNLGKATTEVKTTKDGTKVKTKTAGKGKTGGTATTIQIADANGGVSEKSLBicp19k AAAAAGNGVFKNLVTALTNISTTDDITKVQTQTIGSGGTGGAATILQLADANGGAALKEV130 ... 4339Identiﬁcation and functional characterization of a novel barnacle cement proteinYouhei Urushida1, Masahiro Nakano1, Satoru Matsuda1, Naoko Inoue2, Satoru Kanai2,Naho Kitamura3, Takashi ... [9]. Total RNA was extracted from basal tissue of thebarnacle by a Total RNA Separator kit (BD BiosciencesClontech, Mountain View, CA, USA), and poly (A) +RNAwas isolated using Oligo(dT)-Latex...

Báo cáo khoa học: Physiological truncation and domain organization of a novel uracil-DNA-degrading factor pdf

... trypsin, and thedigests were analyzed by LC-MS ⁄ MS analysis as in [40–42].Catalytic assayFor plasmid substrates, uracil-containing plasmid DNAwas prepared by ampliﬁcation of normal plasmid DNA(pSUPERIOR-puro; ... serum at 1 : 180 000 dilution as primary anti-body, and peroxidase-labeled secondary antibody. Extracts from D. melanogaster and T. castaneum larvae were pre-pared with the addition of protease ... ultracentrifugation analysisAn Optima XL -A analytical ultracentrifuge (Beckman-Coulter, Palo Alto, CA, USA) was used to perform theanalytical ultracentrifugation experiments. Detection wasperformed...

Báo cáo khoa học: Identiﬁcation and structural characterization of a sialylated lacto-N-neotetraose structure in the lipopolysaccharide of Haemophilus inﬂuenzae pptx

... that lack a capsular structure, which in itself providesserum resistance. Recent data from our laboratory indicatethat the ability of acapsular strains of H. inﬂuenzae toelaborate sialylated ... Encapsulated strains can cause invasive,bacteraemic infections such as septicemia and strainslacking a capsule, so-called nontypeable strains (NTHi),are a common cause of otitis media and acute lowerrespiratory ... lic 2A, RM118lpsA and RM118lgtF before and after treatment with neuraminidase (as indicated by – and +, respectively). The sialylated tetrasaccharide-containing glycoformsare indicated by an asterisk....

Tài liệu Báo cáo khoa học: Puriﬁcation and structural characterization of a D-amino acid-containing conopeptide, conomarphin, from Conus marmoreus docx

... (Uppsala, Sweden), a ZORBAX300SB-C18 semipreparative column was from Agilent Tech-nologies (Santa Clara, CA, USA), and triﬂuoroacetic acid and acetonitrile used for HPLC were from Merck (Darms-tadt, ... of conotoxins and their analogs [24–27].Most NOESY crosspeaks were assigned and inte-grated, with concomitant cycles of structure calcula-tions for evaluation of distance and angle constraintviolations ... program sparky(v. 1.113). Non-stereospeciﬁcally assigned atoms were trea-ted as pseudo-atoms and given correction distances. A set of distance restraints was generated from these data and used as...

Tài liệu Báo cáo khoa học: Puriﬁcation and cDNA cloning of a cellulase from abalone Haliotis discus hannai ppt

... CTGATCTAGAGGTACCGGATCC5RACF ATCCTCACGAACAAGCAG5RACR GATCGCGATGCAGGCCTTFLF1 GGACGACTACAGCGTCTTCAGTAGAFLR1 TCCAAACAGTCAGTTTCTTAACCGTTable 1. Puriﬁcation of cellulase from abalone Haliotis discus hannai. ... The translational start codon ATG, termination codon TAA, and a putative polyadenylation signal AATAAA are boxed. A putative signal peptide is indicated by a dotted underline. The amino-acid sequences ... above.Temperature dependence of cellulase activity was assayed at4–80 °C and pH 7.0. Thermal stability of cellulase wasassayed by measuring remaining activity of the enzyme thathad been incubated at...

Tài liệu Báo cáo khoa học: Molecular characterization and allergenic activity of Lyc e 2 (b-fructofuranosidase), a glycosylated allergen of tomato pdf

... We also found reactivity of some serato a 9- and a 15-kDa band. We could show that the9-kDa band in the tomato extracts reacts with a speciﬁcantibody against the LTP from cherry, Pru av 3 and ... N-terminal sequence of the mature protein: 5¢TATGCGTGGTCCAATGCTATGC, and FF 3A, matchingwith the C-terminal sequence of the coding region: 5¢TTACAAGGACAAATTAATTGTGCCAG. For ampliﬁcation of the ... 2003Molecular characterization and allergenic activity of Lyc e 2(b-fructofuranosidase), a glycosylated allergen of tomatoSandra Westphal1, Daniel Kolarich2, Kay Foetisch1, Iris Lauer1,...

Báo cáo khoa học: Improving thermostability and catalytic activity of pyranose 2-oxidase from Trametes multicolor by rational and semi-rational design pdf

... substrate, with the concentration of O2as electron acceptor held constant. Kinetic data were determined at 30 °Cusing the standard ABTS assay and air saturation.VariantD-Glucose D-GalactoseKm(mM) ... system(Peqlab, Erlangen, Germany) and using the molecular massstandards High Molecular Weight Calibration Kit fornative electrophoresis (Amersham Pharmacia, Piscataway,NJ, USA) and the Precision ... ﬁrst-order reac-tions: a ﬁrst phase of rapid activity loss and, after a short transition, a prolonged second phase of moderate activity loss. This behaviour could indicate an inactiva-tion procedure...

Báo cáo khoa học: Global shape and pH stability of ovorubin, an oligomeric protein from the eggs of Pomacea canaliculata pot

... Castro-Vazquez A (2005) Control of the seasonal arrest of copulation and spawning in the apple snail Pomacea canaliculata(Prosobranchia: Ampullariidae): differential effects of food availability, water ... Effects of submersion and aerial exposure on clutches and hatchlings of Pomacea canaliculata (Gastropoda: Amp-ullariidae). Am Malacol Bull 20, 55–63.3 Albrecht EA, Koch E, Carren˜o NB & Castro-Vazquez ... spectroscopy. Analysis of SAXS data shows that ovorubinis an anisometric particle with a major axis of 130 A ˚ and a minor onevarying between 63 and 76 A ˚. The particle shape was not signiﬁcantlyaffected...

Xem thêm