Báo cáo hóa học: " A Novel Algorithm of Surface Eliminating in Undersurface Optoacoustic Imaging" docx
báo cáo hóa học:" A novel role of HLA class I in the pathology of medulloblastoma" docx
... 5'-TAT-AGTCGACCACCCGGACTCAGAATCTCCT-3' and 5'-ATATGGATCCATCTCAGTCCCTCACAAGA-3' (HLA -A) ,5'-TATAGTCGACCACCCGGACTCAGAGTCTCCT-3' and5'-ATATGGATCCATCTCAGTCCCTCACAAGA-3' ... and5'-ATATGGATCCATCTCAGTCCCTCACAAGA-3' (HLA-B), 5'-ACCTGTACGCCAACACAGTG-3' and 5'-GCCAT-GCCAATCTCATCTT-3' (β-Actin), 5'-CTGAAGGAGAC-CATTGGTGA and 5'-GGTACTGGTACACAGTTCGA-3'(CD45). The reactions ... TAP1), 5'-GTACAACACCCGCCATCAG-3' and 5'-GGACGTAGGG-TAAACGTCAGC-3' (TAP2), 5'-CTCGCGCTACTCTCTCTT-3' and 5'-AAGACCAGTCCTTGCTGA-3' (β2m), 5'-TAT-AGTCGACCACCCGGACTCAGAATCTCCT-3'...
- 13
- 529
- 0
Báo cáo khoa học: A novel isoform of pantothenate synthetase in the Archaea potx
... in most of the Archaea, except in the Thermoplasmata class of the Euryarchaeota and in Nanoarchaeum equitans.Also, they are absent from the Bacteria andEukaryota. All of the Archaea that have ... summary,MM2281 catalyzed significant transfer of 14C-labelfrom b-alanine to pantothenate in presence of pantoateand ADP. When pantoate was removed, the resultingpantothenate–b-alanine exchange ... XL1Blue(Stratagene) using Pfu polymerase and the primersdCGCGCCTCGAGGAGGAGTCACGTTATGTTAATTATCGAAACC and dGCGCGTCTAGATTACGCCAGCTCGACCATTTT. The PCR product was inserted into pBlue-script KS (Stratagene)...
- 11
- 626
- 0
Báo cáo hóa học: " A comparative analysis of viral matrix proteins using disorder predictors" docx
... strains of the influenza, there are effec-tive vaccines against specific strains of the virus. Similarly,there are also effective vaccines available of EIAV. Note,matrix proteins of both influenza ... in certain parts of Africa, beingfound in about 10% of HIV cases in West Africa, and hasrecently been found to be spreading in some parts of India[8,11]. While the onset of AIDS usually occurs ... symptoms are seen in virtually all HIV-1 infectedpatients, AIDS symptoms of HIV-2 infection appears only in a small percentage of patients. We believe that a com-parative analysis of PID in related...
- 10
- 449
- 0
báo cáo hóa học:" A new example of viral intein in Mimivirus" potx
... Hirata R, Ohsumk Y, Nakano A, Kawasaki H, Suzuki K, Anraku Y:Molecular structure of a gene, VMA1, encoding the catalyticsubunit of H(+)-translocating adenosine triphosphatasefrom vacuolar ... Variola virus, Asfarvirus, eukaryotic DNA polymerase α and δ catalytic subunits, and archaeal DNA polymerase I. Intein containing genes are indicated by bold letters in the figure. Numbers in ... remotely relatedorganisms. Proc Natl Acad Sci U S A 1997, 94:7851-7856.21. Tajima K, Nagamine T, Matsui H, Nakamura M, Aminov RI: Phyloge-netic analysis of archaeal 16S rRNA libraries from...
- 7
- 321
- 0
Báo cáo hóa học: " A novel adenovirus vector for easy cloning in the E3 region downstream of the CMV promoter" pot
... Ristriani T, Dery-ckere F, Sibler AP, Desplancq D, Atkinson RA, Weiss E, OrfanoudakisG, Kieffer B, Trave G: Structural and functional analysis of E6oncoprotein: insights in the molecular pathways ... conven-tional approaches and can be used by those who are notfamiliar with the homologous recombination system.Competing interestsThe authors declare that they have no competing interests.Authors' ... Lagrange M, Charbonnier S, Orfanoudakis G, Robinson P, Zanier K,Masson M, Lutz Y, Trave G, Weiss E, Deryckere F: Binding of human papillomavirus 16 E6 to p53 and E6AP is impaired bymonoclonal...
- 4
- 451
- 0
Báo cáo hóa học: " A novel cloning strategy for isolating, genotyping and phenotyping genetic variants of geminiviruses" pdf
... Montpellier, FranceEmail: Cica Urbino* - cica.urbino@cirad.fr; Gael Thébaud - gael.thebaud@supagro.inra.fr; Martine Granier - martine.granier@cirad.fr; Stéphane Blanc - stephane.blanc@supagro.inra.fr; ... cul-tivated at 28°C on LB medium containing kanamycin andgentamycin, and used for agroinoculation as describedbelow.Plant inoculationTomato plants cv. Nainemor were inoculated at the two-leaf ... nMSequencing of TYLCV cloned sequencespGreen1589 (+) CACGACGTTGTAAAACGACGpG1825(-) CACAGGAAACAGCTATGACC579 (+) GATGTTACTCGTGGATCTGG1141 (+) CATGATCAACTGCTCTGATTAC1741(+) GGGCTTCCCGTACTTTGTG2321(+)...
- 10
- 396
- 0
báo cáo hóa học:" A novel multiplex assay combining autoantibodies plus PSA has potential implications for classification of prostate cancer from non-malignant cases" ppt
... humanIgGandPSAweremixedinthemultiplexassaytoaccommodate staining of autoAb and PSA binding todistinct seroMAP regions, allowing simultaneous quanti-fication of autoAb plus PSA in one reaction ... monoclonal Abagainst human PSA (Biocon, Inc. Rockville, MD) toquantify total PSA levels. sero MAP-based PSA quantifi-cation was compared with standard ELISA-based PSAassays (American Qualex) and ... the past, including isoforms of PSA such asfree PSA and proPSA [22], new cancer biomarkers such asPCA3 [23], as well as combinatory assays measuring PSAand other parameters such as AMACR [24,25]....
- 11
- 434
- 0
Báo cáo hóa học: " A novel simultaneous dynamic range compression and local contrast enhancement algorithm for digital video cameras" potx
... the local statistical characteristics of the image. Sincethe simplest local statistical measure of the image is thelocal mean in a local window, the parameter m(x, y)isdefined as a linear function ... recording, but also in a variety of image-based technical applications such asvisual tracking, visual surveillance, and visual servoing.Although video capture becomes an easy task, theimages taken ... increasing the value of parameter Sigma isable to increase the local contrast enhancement capabil-ity of the proposed method, it may introduce unwantedartifacts, such as image noise and halo...
- 19
- 353
- 0
báo cáo hóa học: " A novel simultaneous dynamic range compression and local contrast enhancement algorithm for digital video cameras" pptx
... of two separate processes, namely, adaptive luminance andadaptive contrast enhancements. The adaptive luminanceenhancement is employed to compress the dynamicrange of the image and the adaptive ... dynamic range (LDR), poorcontrast,colordistortion,etc.Asaresult,thestudyofimage enhancement to improve visual quality has gainedincreasing attention and becomes an active area in image and ... hyperbolic transfer function and is calculated basedon the local statistical characteristics of the image. Sincethe simplest local statistical measure of the image is thelocal mean in a local window,...
- 19
- 463
- 0
Báo cáo hóa học: " A Novel Self-aligned and Maskless Process for Formation of Highly Uniform Arrays of Nanoholes and Nanopillars" pot
... becoming widely used, there is anincreasing demand for rapid, parallel fabrication strategiesfor nanoholes and nanopillars. Some applications thatrequire repetitive uniform nanoholes and nanopillars ... 0.7% of the change of sphere’sdiameters. Highly uniform micro- and nanospheres with a standard deviation of about 1.3% can be obtained in themarket [8], and hence the standard deviation of the ... hexagonallypacked gold nanoposts and nanoholes in gold thin filmusing the uniform HCP nanoholes and nanopillars of photoresist for lift-off process, as shown in Fig. 5a and b.These metal nanoposts...
- 5
- 281
- 0
Từ khóa: Nghiên cứu tổ hợp chất chỉ điểm sinh học vWF, VCAM 1, MCP 1, d dimer trong chẩn đoán và tiên lượng nhồi máu não cấpNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinSở hữu ruộng đất và kinh tế nông nghiệp châu ôn (lạng sơn) nửa đầu thế kỷ XIXChuong 2 nhận dạng rui roTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ