Báo cáo hóa học: " A Combined Intensity and Gradient-Based Similarity Criterion for Interindividual SPECT Brain Scan Registration Roger Lundqvist" docx

báo cáo hóa học: " A prototype power assist wheelchair that provides for obstacle detection and avoidance for those with visual impairments" pptx

báo cáo hóa học: " A prototype power assist wheelchair that provides for obstacle detection and avoidance for those with visual impairments" pptx

... with manual wheelchairs. In general, manual wheelchairs are lighter and more maneuverable than power wheelchairs, and can be transported in a car. Manual wheelchairs that make use of power assist ... power assistance for a manual wheelchair is relatively new, and represents a viable alternative for indi- viduals who are unable to generate sufficient propulsion force to use a...

Ngày tải lên: 19/06/2014, 10:20

11 421 0
báo cáo hóa học: " A neural tracking and motor control approach to improve rehabilitation of upper limb movements" potx

báo cáo hóa học: " A neural tracking and motor control approach to improve rehabilitation of upper limb movements" potx

... Corazza S, Mundermann L, Chaudhari AM, Demattio T, Cobelli C, Andriacchi TP: A markerless motion capture system to study musculoskeletal biomechanics: Visual hull and simulated annealing approach. ... 2006; Karnataka Edited by: Nagabhushan P, Kulkarni L. Delhi: Macmillan India; 2006. 34. Kurosawa K, Futami R, Watanabe T, Hoshimiya N: Joint angle con- trol by FES using a feedback error...

Ngày tải lên: 19/06/2014, 10:20

12 559 0
báo cáo hóa học:" En bloc excision and autogenous fibular reconstruction for aggressive giant cell tumor of distal radius: a report of 12 cases and review of literature" doc

báo cáo hóa học:" En bloc excision and autogenous fibular reconstruction for aggressive giant cell tumor of distal radius: a report of 12 cases and review of literature" doc

... were operated under general anaesthesia and ipsilateral leg, arm and iliac crest were prepped and draped appropriately. A pneumatic tourniquet was used at both surgical sites. Surgical approach chosen ... routinely taken a nd applied at fibuloradial junction. After careful haemostasis, wound was closed over a suction drain and an above elbow slab was applied. Full weight bearing...

Ngày tải lên: 20/06/2014, 04:20

9 466 0
báo cáo hóa học:" En bloc excision and autogenous fibular reconstruction for aggressive giant cell tumor of distal radius: a report of 12 cases and review of literature" ppt

báo cáo hóa học:" En bloc excision and autogenous fibular reconstruction for aggressive giant cell tumor of distal radius: a report of 12 cases and review of literature" ppt

... over a suction drain. Newly harvested fibular graft was placed in ipsilateral forearm and radiocarpal ligaments were repaired to lat- eral collateral ligament. After reduction of newly formed fibula ... ligaments, if not involved, as these were later repaired to ligaments attached to proximal fibula to form a stable wrist joint. Ipsilateral fibula was approached from standard direct lat...

Ngày tải lên: 20/06/2014, 07:20

9 704 0
báo cáo hóa học:" A Population-Based and Longitudinal Study of Sexual Behavior and Multidrug-Resistant HIV Among Patients in Clinical Care" pdf

báo cáo hóa học:" A Population-Based and Longitudinal Study of Sexual Behavior and Multidrug-Resistant HIV Among Patients in Clinical Care" pdf

... sexual behav- ior and events all vaginal, anal, and oral insertive sexual events, protected (condom used) and unprotected; and (3) unprotected sexual behavior and events: unprotected vaginal, anal, ... psycho- logical, and medical findings. AIDS 2002, 16:135-149. Abstract 21. Crepaz N, Hart TA, Marks G: Highly active antiretroviral ther- apy and sexual risk behavior: A meta-an...

Ngày tải lên: 20/06/2014, 08:20

8 433 0
báo cáo hóa học:" A biregional survey and review of first-line treatment failure and second-line paediatric antiretroviral access and use in Asia and southern Africa" pot

báo cáo hóa học:" A biregional survey and review of first-line treatment failure and second-line paediatric antiretroviral access and use in Asia and southern Africa" pot

... General Hospital, Jakarta, Indonesia; SM Fong* and M Thien, Hospital Likas, Kota Kinabalu, Malaysia; NK Nik Yusoff* and LC Hai, Hospital Raja Perempuan Zainab II, Kelantan, Malaysia; K Razali* and ... Jourdain, Program for HIV Prevention and Treatment, Chiang Mai, Thailand; J Ananworanich*† and T Suwanlerk, The Netherlands, Australia, Thailand Research Collaboration (HIV-NAT), Ban...

Ngày tải lên: 20/06/2014, 08:20

8 364 0
báo cáo hóa học:" A biregional survey and review of first-line treatment failure and second-line pediatric antiretroviral access and use in Asia and southern Africa" pdf

báo cáo hóa học:" A biregional survey and review of first-line treatment failure and second-line pediatric antiretroviral access and use in Asia and southern Africa" pdf

... 2011 Reference 1. TREAT Asia Pediatric HIV Observational Database (TApHOD), and The International Epidemiologic Databases to Evaluate AIDS (IeDEA) Southern Africa Paediatric Group: A biregional survey and review ... Table 1 First- and second-line antiretroviral therapy regimens in use in TREAT Asia and IeDEA Southern Africa (Continued) Hospital Raja Perempuan Zainab Malaysia <3yr...

Ngày tải lên: 20/06/2014, 08:20

3 343 0
Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt

Báo cáo hóa học: " A quantum dots and superparamagnetic nanoparticle-based method for the detection of HPV DNA" ppt

... probe 5-GAGGAGGATGAAATAGATGGTCCAGCTGG ACAAGCAGAACCGGACAGAGCCCATTACAATAT TGTAACCTTTTGTTGCAAGTGTGACTCT ACGCTTCGGT-3 Secondary probe 5-GGAGCGACCCAGAAAGTTACCACAGTTATGC ACAGAGCTGCAAACAACTA-3 Type-specific ... imaging, labelling and sensing. Nat Mater 2005, 4:435-446. 16. Ma HL, Qi XR, Maitani Y, Nagai T: Preparation and characterization of superparamagnetic iron oxide nanoparticles stabilized...

Ngày tải lên: 21/06/2014, 01:20

9 469 0
báo cáo hóa học: " A geometrical constant and normal normal structure in Banach Spaces" potx

báo cáo hóa học: " A geometrical constant and normal normal structure in Banach Spaces" potx

... Introduction and preliminaries We assume that X and X* stand for a Banach space and its dual space, respectively. By S X and B X we denote the unit sphere and the unit ball of a Bana ch space X, respec- tively. ... with uniform normal structure. Studia Math. 99,41–56 (1991) 2. Kato, M, Maligranda, L, Takahashi, Y: On James and Jordan-von Neumann constants and normal struct...

Ngày tải lên: 21/06/2014, 02:20

10 253 0
báo cáo hóa học:" A multimodal tempo and beat-tracking system based on audiovisual information from live guitar performances" ppt

báo cáo hóa học:" A multimodal tempo and beat-tracking system based on audiovisual information from live guitar performances" ppt

... msec for detected beats and 10 bpm for estimated tempos, respectively. Two evaluative standard are used, F-measure and AMLc. F-measure is a harmonic mean of preci- sion (r prec ) and recall (r recall ) ... tracking. 3.2.1 Hand candidate area estimation by optical flow We use Lucas–Kanade (LK) method [21] for fast optical-flow calculation. Figure 4 shows an example of the result of...

Ngày tải lên: 21/06/2014, 20:20

29 310 0
w