Báo cáo hóa học: " A Self-Localization Method for Wireless Sensor Networks" doc
Báo cáo hóa học: " A novel method for neck coordination exercise – a pilot study on persons with chronic non-specific neck pain" docx
... authors would like to thank Nisse Larson for excellent engineering assistance, Maria Frykman for valuable assistance during data collection and Margaretha Marklund for graphical work. References 1. ... study, participated in the design, statistical analyses of the study and helped to draft the manuscript. All authors read and approved the final manuscript. Additional material Acknowle...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học: "A binary method for simple and accurate two-dimensional cursor control from EEG with minimal subject training" potx
... an optimum channel/bin, so we used Bhattacharyya distance plots for real movementFigure 2 Bhattacharyya distance plots for real movement. Higher values indicate greater class separability. (a) ... Piccione's system had an average accuracy of 76.2% and a bit rate of 7.59 bits/min with healthy trained subjects [15]. Based on these results, our method appears to have a higher accu...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học:" A general method for nested RT-PCR amplification and sequencing the complete HCV genotype 1 open reading frame" pdf
... Transcriptase (M-MLV RT; Promega) and Enhanced Avian Reverse Transcriptase (AMV-RT; Sigma), an enhanced avian myeloblastosis virus reverse tran- scriptase. Reactions were assembled per manufacturer's instructions ... authorized users with valid passwords. The database and all sequence data are backed up to a secure tape- backup system in a different building three times a week. The...
Ngày tải lên: 20/06/2014, 04:20
báo cáo hóa học:" A rapid method for the generation of uniform acellular bone explants: a technical note" pot
... participated in the planning of the experiments, data analysis and the preparation of the manuscript. MJS supervised the study plan- ning, data analysis and preparation of the manuscript. All authors ... (Invit- rogen), and 10% fetal calf serum (FCS; South American origin, biowest). Viability was analyzed using a lactate dehydrogenase (LDH) assay [4], with a day 0 non-culture group to pro...
Ngày tải lên: 20/06/2014, 04:20
báo cáo hóa học:" A promising method for identifying cross-cultural differences in patient perspective: the use of Internet-based focus groups for content validation of new Patient Reported Outcome assessments" potx
... 5 Kaufman Associates, 6 Fennwood Drive, Atherton, CA 94027, USA and 6 President and Chief Technical Officer, FocusForums™, Calgary, Alberta T3K 6J1, Canada Email: Mark J Atkinson* - mjatkinson@ucsd.edu; ... mjatkinson@ucsd.edu; Jan Lohs - lohsrsch@aol.com; Ilka Kuhagen - ilka.kuhagen@ikmarketing.de; Julie Kaufman - kaufmanassoc@yahoo.com; Shamsu Bhaidani - sbhaidani@focusforums.net * Cor...
Ngày tải lên: 20/06/2014, 15:20
Báo cáo hóa học: " Radio resource management for public femtocell networks" docx
... action a and then transforms from state s to s’ by a certain probability p, after that it will generate a current reward r and feed back to agent. 4. The agent updates its strategy π: S ® A according to ... Q(s total , a 1 ) a max (p a max , c a max ) Q(s 1 ,a max ) Q(s total , a max ) Li et al. EURASIP Journal on Wireless Communications and Networking 2011, 2011:18...
Ngày tải lên: 20/06/2014, 22:20
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf
... primers: Aba, 5¢-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG-3¢;Abb, 5¢-GTTCACCACCAGAAGCT GGTGTTCTTC GCTGAA GACGT GGGTTCT AACAAG GGTGCT-3¢;Abc, 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢;Ab- start, ... 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢;Ab- start, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢;Abstop, 5¢-CCTGCCGAGCTCCTATTA CACAACGCCACCAACC...
Ngày tải lên: 18/02/2014, 13:20
Báo cáo khoa học: "A Nonparametric Method for Extraction of Candidate Phrasal Terms" docx
... Annual Meeting of the Association for Computational Linguistics, pages 188-195. Ferreira da Silva, J. and G. Pereira Lopes (1999). A local maxima method and a fair dispersion normalization for ... 605–613, Ann Arbor, June 2005. c 2005 Association for Computational Linguistics A Nonparametric Method for Extraction of Candidate Phrasal Terms Paul Deane Center for Ass...
Ngày tải lên: 08/03/2014, 04:22
Báo cáo khoa học: "A Bayesian Method for Robust Estimation of Distributional Similarities" pot
... Estimation of Distributional Similarities Jun’ichi Kazama Stijn De Saeger Kow Kuroda Masaki Murata † Kentaro Torisawa Language Infrastructure Group, MASTAR Project National Institute of Information ... of ACL 94. Ido Dagan, Shaul Marcus, and Shaul Markovitch. 1995. Contextual word similarity and estimation from sparse data. Computer, Speech and Language, 9:123–152. Ido Dagan, Lillian Lee, and...
Ngày tải lên: 30/03/2014, 21:20
Báo cáo khoa học: "A Unification Method for Disjunctive Feature Descriptions" pot
... a formula contain informa- tion that is more definite than the information contained in disjunctions. Thus a formula can be regarded as having a definite part, containing only unconditional ... Press, Cam- bridge, England, 1985. [8] Perelra, F. C. N. and D. H. D. Warren. Definite clause grammars for language analysis - a survey of the formal- ism and a comparison with augme...
Ngày tải lên: 31/03/2014, 17:20