Báo cáo hóa học: " Parameter Estimation of a Plucked String Synthesis Model Using a Genetic Algorithm with Perceptual Fitness Calculation" ppt

Báo cáo hóa học: " Objective assessment of motor fatigue in multiple sclerosis using kinematic gait analysis: a pilot study" docx

Báo cáo hóa học: " Objective assessment of motor fatigue in multiple sclerosis using kinematic gait analysis: a pilot study" docx

... motor fatigue can be defined as a reduction in maximal walking distance that cannot be explained by the degree of paresis, ataxia or spasticity. Many patients with motor fatigue demo nstrate a gait ... , and medi o-later al sway of the upper body were calculated for each step using the three-dimensional coordinates of the infrared markers. Mean and standard deviations for each...

Ngày tải lên: 19/06/2014, 08:20

13 434 0
Báo cáo hóa học: " Experimental observations of rapid Maize streak virus evolution reveal a strand-specific nucleotide substitution bias" potx

Báo cáo hóa học: " Experimental observations of rapid Maize streak virus evolution reveal a strand-specific nucleotide substitution bias" potx

... the evolution rates of ssDNA and dsDNA viruses, proof of this may ultimately require a detailed comparative analysis of the individual impacts of all mutagenic reactions and repair pathways acting on ... Martin DP, Shepherd DN, Edema R, Monjane AL, Rybicki EP, Thomson JA, Varsani A: Genetic analysis of maize streak virus isolates from Uganda reveals widespread distribution of...

Ngày tải lên: 20/06/2014, 01:20

11 308 0
Báo cáo hóa học: " Quantitative estimation of Nipah virus replication kinetics in vitro" potx

Báo cáo hóa học: " Quantitative estimation of Nipah virus replication kinetics in vitro" potx

... KT, Kamarulzaman A, Tan PSK, Ksiazek TG, Zaki SR, Paul G, Lam SK, Tan CT: Fatal encephalitis due to Nipah virus among pig-farmers in Malaysia. Lancet 1999, 354:1257-1259. 20. AbuBakar S, Chang ... Laboratories, Inc., USA). Primer pairs NIP-NF3 (5' GGC TAG AGA GGC AAA ATT TGC TGC 3') and NIP-NR1 (5' ACC GGA TGT GCT CAC AGA ACT G 3'), designed from the conserved region with...

Ngày tải lên: 20/06/2014, 01:20

7 386 0
Báo cáo hóa học: " Blind recovery of k/n rate convolutional encoders in a noisy environment" pdf

Báo cáo hóa học: " Blind recovery of k/n rate convolutional encoders in a noisy environment" pdf

... identification of a dual code basis, and (iii) identifica- tion of parity checks and a generator matrix. Each step consist of maximum (l max - 1) process of Gaussian elim- inations on R l matrices of ... properties of both optimal convolutional encoders and their dual code. This algo- rithm allows the identification of parameters and genera- tor matrix of a rate k/n conv...

Ngày tải lên: 20/06/2014, 22:20

9 495 0
Báo cáo hóa học: " Reduced cytotoxicity of insulin-immobilized CdS quantum dots using PEG as a spacer" pot

Báo cáo hóa học: " Reduced cytotoxicity of insulin-immobilized CdS quantum dots using PEG as a spacer" pot

... Zheng J, Takahashi T, Imanishi Y: Enhancement of artificial juxtacrine stimulation of insulin by co-immobilization with adhesion factors. Journal of Biomedical Materials Research Part A 1997, 37:190. 33. ... distributions of (a) mercaptoacetic acid- coated CSNPs and (b) ICSNPs. As measured by dynamic light scattering. Figure 5 Proliferation of human fibroblasts after 6 and 24 h...

Ngày tải lên: 20/06/2014, 22:20

9 403 0
Tài liệu Báo cáo khoa học: PCR detection of nearly any dengue virus strain using a highly sensitive primer ‘cocktail’ ppt

Tài liệu Báo cáo khoa học: PCR detection of nearly any dengue virus strain using a highly sensitive primer ‘cocktail’ ppt

... Group 4 ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT DENV-3 104 382 279 1G5P30 Group 5 TTCCAACAAGCAGAACAACAT GCTACAGGCAGCACGGTTT DENV-4 9903 10318 415 C. Gijavanekar et al. PCR detection of nearly any ... CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA DENV-1 92.1 ± 0.57 73.6 ± 2.31 1G4P217 ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT DENV-3 90.3 ± 1.09 83.9 ± 5.16 1G5P30 TTCCAACAAGCAGAACAACAT GCTACAGGCAG...

Ngày tải lên: 14/02/2014, 19:20

12 796 0
báo cáo hóa học:" Molecular Etiology of Hearing Impairment in Inner Mongolia: mutations in SLC26A4 gene and relevant phenotype analysis" ppt

báo cáo hóa học:" Molecular Etiology of Hearing Impairment in Inner Mongolia: mutations in SLC26A4 gene and relevant phenotype analysis" ppt

... different populations a Chinese a Chinese a Taiwanese a Korean a Japanese a French a Caucasian European a US a Total number of patients 135 NSHI (20 EVA) 95 EVA 38 EVA 26 EVA 10 PS + 32 EVA 30 PS ... Shaukat S, Liu XZ, Hahn SH, Naz S, Ghosh M, Kim HN, Moon SK, Abe S, Tukamoto K, Riazuddin S, Kabra M, Erdenetungalag R, Rad- naabazar J, Khan S, Pandya A, Usami SI, Nanc...

Ngày tải lên: 18/06/2014, 15:20

12 549 0
báo cáo hóa học:" Proteomic characterization of HIV-modulated membrane receptors, kinases and signaling proteins involved in novel angiogenic pathways" ppt

báo cáo hóa học:" Proteomic characterization of HIV-modulated membrane receptors, kinases and signaling proteins involved in novel angiogenic pathways" ppt

... 2002, 277:5441-5447. 138. Tazaki T, Miyazaki K, Hiyama E, Nakamoto T, Sakai R, Yamasaki N, Honda Z, Noda M, Miyasaka N, Sueda T, Honda H: Functional anal- ysis of Src homology 3-encoding exon (exon 2) of p130Cas in primary ... Inher- itance in Man (OMIM), a database of human genes and genetic disorders. The Ingenuity Pathway Analyses (IPA) Systems and Computational Biology programs...

Ngày tải lên: 18/06/2014, 15:20

24 507 0
Báo cáo hóa học: " Boosting high-intensity focused ultrasoundinduced anti-tumor immunity using a sparse-scan strategy that can more effectively promote dendritic cell maturation" ppt

Báo cáo hóa học: " Boosting high-intensity focused ultrasoundinduced anti-tumor immunity using a sparse-scan strategy that can more effectively promote dendritic cell maturation" ppt

... fact, distant metastasis is a major cause of mortality following clinical HIFU therapy[1 0]. Lengthy treatment time also represents a limitation. Because each HIFU pulse generally creates an ablated spot ... (Gibco, USA) at 37°C and 5% CO 2 . Experimental animals and Tumor Model C57BL/6 female mice, 5-8 weeks old, were purchased from Shanghai SLAC Laboratory Animal CO. LTD (Shanghai ,...

Ngày tải lên: 18/06/2014, 16:20

12 345 0
w