Báo cáo hóa học: " Distributed Detection and Fusion in a Large Wireless Sensor Network of Random Size" pot

Báo cáo hóa học: " Distributed Detection and Fusion in a Large Wireless Sensor Network of Random Size" pot

Báo cáo hóa học: " Distributed Detection and Fusion in a Large Wireless Sensor Network of Random Size" pot

... Communications and Networking 2005:4, 462–472 c  2005 R. Niu and P. K. Varshney Distributed Detection and Fusion in a Large Wireless Sensor Network of Random Size Ruixin Niu Department of Electrical ... ROI, as shown in Figure 2. Instead of transmitting data to a faraway central fusion center, sensors will send data to their corresponding cluster head. B...

Ngày tải lên: 23/06/2014, 00:20

11 263 0
báo cáo hóa học: " Interleukin-1β and anaphylatoxins exert a synergistic effect on NGF expression by astrocytes" potx

báo cáo hóa học: " Interleukin-1β and anaphylatoxins exert a synergistic effect on NGF expression by astrocytes" potx

... acted via the anaphylatoxins/anaphylatoxin receptors and was not due to contaminants in anaphyla- toxin preparations. Analysis of NGF mRNA expression following anaphyla- toxin stimulation was also ... obtain further clues on the potential roles of C 3a and C 5a anaphylatoxins in neu- roprotection by investigating the effects of C 3a and C 5a in parallel with their peptid...

Ngày tải lên: 19/06/2014, 22:20

10 777 0
Báo cáo hóa học: " Optimal Throughput and Energy Efficiency for Wireless Sensor Networks: Multiple Access and Multipacket " potx

Báo cáo hóa học: " Optimal Throughput and Energy Efficiency for Wireless Sensor Networks: Multiple Access and Multipacket " potx

... “Energy-constrained modulation optimization,” to appear in IEEE Transactions on Wireless Communications. [6] J. Chou, D. Petrovic, and K. Ramachandran, A distributed and adaptive signal processing approach ... While shadow fading generally increases the dynamism of individ- ual link quantity, which leads to larger outage probability and is unfavorable to real-time applications,...

Ngày tải lên: 23/06/2014, 00:20

13 401 0
báo cáo hóa học:" Male gender predicts mortality in a large cohort of patients receiving antiretroviral therapy in Uganda" ppt

báo cáo hóa học:" Male gender predicts mortality in a large cohort of patients receiving antiretroviral therapy in Uganda" ppt

... retention, and include innovative approaches to maintaining patient interest, including drama and social groups, diary writing and involvement of patients in clinical duties to become “expert patients”. TASO ... edward.mills@uottawa.c a 1 Faculty of Health Sciences, University of Ottawa, Ottawa, Canada Full list of author information is available at the end of the article...

Ngày tải lên: 20/06/2014, 08:20

7 256 0
Báo cáo hóa học: " Virus detection and identification using random multiplex (RT)-PCR with 3''''-locked random primers" ppt

Báo cáo hóa học: " Virus detection and identification using random multiplex (RT)-PCR with 3''''-locked random primers" ppt

... Strand = Plus / Minus Query: 3 gcaaggaaggtaatacagcaccgctatgcacccacccaggaccacccctaaaatcaaata 62 |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 26967 gcaaggaaggtaatacagcaccgctatgcacccacccaggaccacccctaaaatcaaata ... |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| Sbjct: 26787 gtcggtaacgttcaccaaagtgaaagtgtggaagcaaggtccgctctggcagtggtaggt 26728 Query: 243...

Ngày tải lên: 20/06/2014, 01:20

11 347 0
Báo cáo hóa học: " Landmine Detection and Discrimination Using High-Pressure Waterjets" potx

Báo cáo hóa học: " Landmine Detection and Discrimination Using High-Pressure Waterjets" potx

... Type of object located at each flag position in field calibration lanes. Flag number 2  sand calibration lane 4  sand calibration lane 2  clay calibration lane 4  clay calibration lane 1 Antipersonnel ... type, the means and standard deviations determined from the sand-only and clay-only data were used to normalize the respective sand and clay data. For evaluation purposes, al...

Ngày tải lên: 23/06/2014, 01:20

12 292 0
báo cáo hóa học:" Mycophenolate pharmacokinetics and pharmacodynamics in belatacept treated renal allograft recipients – a pilot study" doc

báo cáo hóa học:" Mycophenolate pharmacokinetics and pharmacodynamics in belatacept treated renal allograft recipients – a pilot study" doc

... the proliferation of activated lymphocytes [6]. MPA demonstrates a narrow therapeutic range and sub- stantial inter- and intraindividual variability of pharma- cokinetic (PK) and pharmacodynamic (PD) parameters. Renal ... following allograft transplantation. The large pharmacokinetic (PK) and pharmacodynamic (PD) variability and narrow therapeutic range of MPA provide a...

Ngày tải lên: 18/06/2014, 15:20

14 533 0
báo cáo hóa học: " Struggles, strengths, and strategies: an ethnographic study exploring the experiences of adolescents living with an ostomy" doc

báo cáo hóa học: " Struggles, strengths, and strategies: an ethnographic study exploring the experiences of adolescents living with an ostomy" doc

... family. Also, increased public edu- cation about pediatric IBD and living with an ostomy, may be of benefit in advancing community and societal knowledge and understanding. Finding ways to advance public ... urban and rural home locations, and they ranged in terms of represented family constellation. The mean age of participants was 15.3 years, and participants ranged fr...

Ngày tải lên: 18/06/2014, 19:20

8 418 0
báo cáo hóa học: "Gait symmetry and regularity in transfemoral amputees assessed by trunk accelerations" pot

báo cáo hóa học: "Gait symmetry and regularity in transfemoral amputees assessed by trunk accelerations" pot

... to acquisition, analysis and interpretation of data. LR has made substantial contributions to analysis and interpretation of data and has been involved in revising the manuscript. AGC has made ... (BO), Italy. Authors’ contributions AT has made substantial contributions to analysis and interpretation of data and has been involved in drafting the manuscript. MR has made sub...

Ngày tải lên: 19/06/2014, 08:20

10 374 0
báo cáo hóa học: " Virtual reality and physical rehabilitation: a new toy or a new research and rehabilitation tool?" pptx

báo cáo hóa học: " Virtual reality and physical rehabilitation: a new toy or a new research and rehabilitation tool?" pptx

... Craig A: Understanding virtual reality: Interface, application, and design California: Morgan Kaufmann; 2002. 7. Stanney KM: Handbook of Virtual Environments: Design, Implementation, and Applications ... considered virtual reality? Factors that differ among many of the lab- oratories claiming to use virtual reality and that also emerge amongst this group of papers include field...

Ngày tải lên: 19/06/2014, 10:20

2 360 0
w