Báo cáo hóa học: " A Posterior Union Model with Applications to Robust Speech and Speaker Recognition" pot

... subbands 2, 3, and 4, resp.), three cases with two subband corruption (a ecting subbands 2 and 3, 3 and 4, and 4 and 5, resp.), and two cases with three subband corruption (a ecting subbands 2, ... identification. The new model estimates the order on a frame-by-frame basis and can be applied to a single-state HMM or GMM. The model is de- fined in (13 )and( 14), and...

Ngày tải lên: 22/06/2014, 23:20

... regular hospital bed has been modified to hold a pneumatic force actuator, a flat friction free surface that supports a back pack frame with air bearings, a visual surround system and a portable air-compressor. ... wear a backpack frame that is freely moving on air-bearings (cf. puck on an air hockey table) and attached through a cable to a pneumatic cylinder that pr...

Ngày tải lên: 19/06/2014, 10:20

... columns are all equal to x. For A ∈ M n , ρ A denotes the spectral radius of A. Let |·|be a norm in C n . A matrix A ∈ M n is a contraction relative to |·|if it is a contraction as a transformation ... necessity part of b.IfA has an eigenvalue λ with |λ| > 1and eigenvector v, then as shown above A k v →∞as k →∞.IfA has 1 as an eigenvalue and index1 ≥ 2, the...

Ngày tải lên: 21/06/2014, 20:20

... Seattle, Wash, USA, May 1998. [16] R. E. Yantorno, K. R. Krishnamachari, J. M. Lovekin, D. S. Ben- incasa, and S. J. Wenndt, “The spectral autocorrelation peak valley ratio (SAPVR) a usable speech ... specifically, AWGN, babble noise, and bandpass fil- tering (300 Hz–3.4 kHz with a 1 dB bandpass ripple) were individually and simultaneously applied to the speech sig- nals to s...

Ngày tải lên: 22/06/2014, 19:20

... solution to navigation in GPS signal degraded areas?. Geomatica. 59(2), 175–182 (2005) 6. M Kourogi, T Ishikawa, Y Kameda, J Ishikawa, K Aoki, T Kurata, Pedestrian dead reckoning and its applications, ... layout map matrix adequate for our simulation environment. The walls are depicted in black, not easily reachable forest area is marked with dark gray, and flowerbed areas are drawn...

Ngày tải lên: 21/06/2014, 01:20

... propose a cascaded linear model for joint Chinese word segmentation and part- of -speech tagging. With a character-based perceptron as the core, combined with real- valued features such as language models, ... at the same time, we expand boundary tags to include POS information by attaching a POS to the tail of a boundary tag as a postfix following Ng and Low (2004). A...

Ngày tải lên: 08/03/2014, 01:20

... Arbor, Michigan, June. Brian Roark, Murat Saraclar, and Michael Collins. 2007. Discriminative n-gram language modeling. computer speech and language. Computer Speech and Lan- guage, 21(2):373–392. Roni ... discrimi- native language model using pseudo-negative exam- ples. We also showed that an online margin-based learning method enabled us to use half a million sen- tences as...

Ngày tải lên: 08/03/2014, 02:21

... Computational Approaches to Linguistic Creativity, pages 71–78. Louise-Amélie Cougnon and Richard Beaufort. 2009. SSLD: a French SMS to standard language dictionary. In Sylviane Granger and Magali ... is an FST corresponding to the list of separators (any non-alphabetic and non- numeric character), mapped onto a SEP marker. 3 Actually, the true complement of I accepts sequence...

Ngày tải lên: 30/03/2014, 21:20

... Shimada K, Iwasaka T, Imaizumi T: Therapeutic angiogenesis for patients with limb ischaemia by autologous transplantation of bone- marrow cells: a pilot study and a randomised controlled trial. Lancet ... 360(9331):427-435. 14. Miyamoto K, Nishigami K, Nagaya N, Akutsu K, Chiku M, Kamei M, Soma T, Miyata S, Higashi M, Tanaka R, Nakatani T, Nonogi H, Take- shita S: Unblinded pilot stud...

Ngày tải lên: 18/06/2014, 15:20

... cgcacatatggatgtcggagttttgaat gcgcggatcctcaactttcgtccttata SElN AF285760 aatgctcatatggacaaaaaagatttaaag gcgcggatccttaatctttatataaaa SElO AF285760 tgcactcgagaatgaagaagatcctaaa cgcgctcgagttatgtaaataaataaac Seo ... (’ 5to3 ’) SEA M18970 cttgtacatatgagcgagaaaagcgaagaa gcgcggatccttaacttgtatataaata SED M28521 cgttctcgagaatgaaaacattgattc cgcgctcgagctacttttcatataaata SEE M21319 ggtagccatatgagcgaagaaat...

Ngày tải lên: 18/06/2014, 16:20