Báo cáo hóa học: " A Posterior Union Model with Applications to Robust Speech and Speaker Recognition" pot
Báo cáo hóa học: " A Posterior Union Model with Applications to Robust Speech and Speaker Recognition" pot
... subbands
2, 3, and 4, resp.), three cases with two subband corruption
(a ecting subbands 2 and 3, 3 and 4, and 4 and 5, resp.), and
two cases with three subband corruption (a ecting subbands
2, ... identification. The new
model estimates the order on a frame-by-frame basis and can
be applied to a single-state HMM or GMM. The model is de-
fined in (13 )and( 14), and...
báo cáo hóa học: " A rehabilitation tool for functional balance using altered gravity and virtual reality" potx
... regular hospital bed
has been modified to hold a pneumatic force actuator, a
flat friction free surface that supports a back pack frame
with air bearings, a visual surround system and a portable
air-compressor. ... wear a backpack frame that is freely moving on air-bearings (cf. puck on an air hockey
table) and attached through a cable to a pneumatic cylinder that pr...
Báo cáo hóa học: " Research Article Nonexpansive Matrices with Applications to Solutions of Linear Systems by Fixed Point Iterations Teck-Cheong Lim" docx
... columns are all equal to x. For A ∈ M
n
, ρ A denotes
the spectral radius of A.
Let |·|be a norm in C
n
. A matrix A ∈ M
n
is a contraction relative to |·|if it is a
contraction as a transformation ... necessity part of b.IfA has an eigenvalue λ with |λ| > 1and
eigenvector v, then as shown above A
k
v →∞as k →∞.IfA has 1 as an eigenvalue and
index1 ≥ 2, the...
Báo cáo hóa học: " Research Article On the Use of Complementary Spectral Features for Speaker Recognition" pot
... Seattle, Wash, USA, May 1998.
[16] R. E. Yantorno, K. R. Krishnamachari, J. M. Lovekin, D. S. Ben-
incasa, and S. J. Wenndt, “The spectral autocorrelation peak
valley ratio (SAPVR) a usable speech ... specifically, AWGN, babble noise, and bandpass fil-
tering (300 Hz–3.4 kHz with a 1 dB bandpass ripple) were
individually and simultaneously applied to the speech sig-
nals to s...
Báo cáo hóa học: " A human motion model based on maps for navigation systems" pptx
... solution
to navigation in GPS signal degraded areas?. Geomatica. 59(2), 175–182
(2005)
6. M Kourogi, T Ishikawa, Y Kameda, J Ishikawa, K Aoki, T Kurata, Pedestrian
dead reckoning and its applications, ... layout map matrix adequate for
our simulation environment. The walls are depicted in
black, not easily reachable forest area is marked with
dark gray, and flowerbed areas are drawn...
Báo cáo khoa học: "A Cascaded Linear Model for Joint Chinese Word Segmentation and Part-of-Speech Tagging" pdf
... propose a cascaded linear model for
joint Chinese word segmentation and part-
of -speech tagging. With a character-based
perceptron as the core, combined with real-
valued features such as language models, ... at the same time, we expand boundary
tags to include POS information by attaching a POS
to the tail of a boundary tag as a postfix following
Ng and Low (2004). A...
Báo cáo khoa học: "A Discriminative Language Model with Pseudo-Negative Samples" pptx
... Arbor,
Michigan, June.
Brian Roark, Murat Saraclar, and Michael Collins. 2007.
Discriminative n-gram language modeling. computer
speech and language. Computer Speech and Lan-
guage, 21(2):373–392.
Roni ... discrimi-
native language model using pseudo-negative exam-
ples. We also showed that an online margin-based
learning method enabled us to use half a million sen-
tences as...
Báo cáo khoa học: "A hybrid rule/model-based finite-state framework for normalizing SMS messages" pot
... Computational Approaches to
Linguistic Creativity, pages 71–78.
Louise-Amélie Cougnon and Richard Beaufort. 2009.
SSLD: a French SMS to standard language
dictionary. In Sylviane Granger and Magali ... is an FST corresponding to the list of
separators (any non-alphabetic and non-
numeric character), mapped onto a SEP
marker.
3
Actually, the true complement of I accepts sequence...
báo cáo hóa học:" A practical approach for the validation of sterility, endotoxin and potency testing of bone marrow mononucleated cells used in cardiac regeneration in compliance with good manufacturing practice" docx
... Shimada
K, Iwasaka T, Imaizumi T: Therapeutic angiogenesis for patients
with limb ischaemia by autologous transplantation of bone-
marrow cells: a pilot study and a randomised controlled trial.
Lancet ... 360(9331):427-435.
14. Miyamoto K, Nishigami K, Nagaya N, Akutsu K, Chiku M, Kamei M,
Soma T, Miyata S, Higashi M, Tanaka R, Nakatani T, Nonogi H, Take-
shita S: Unblinded pilot stud...
Báo cáo hóa học: " A quantitative real time PCR method to analyze T cell receptor Vb subgroup expansion by staphylococcal superantigens" doc
... cgcacatatggatgtcggagttttgaat gcgcggatcctcaactttcgtccttata
SElN AF285760 aatgctcatatggacaaaaaagatttaaag gcgcggatccttaatctttatataaaa
SElO AF285760 tgcactcgagaatgaagaagatcctaaa cgcgctcgagttatgtaaataaataaac
Seo ... (’ 5to3 ’)
SEA M18970 cttgtacatatgagcgagaaaagcgaagaa gcgcggatccttaacttgtatataaata
SED M28521 cgttctcgagaatgaaaacattgattc cgcgctcgagctacttttcatataaata
SEE M21319 ggtagccatatgagcgaagaaat...