Báo cáo hóa học: " 3D-SoftChip: A Novel Architecture for Next-Generation Adaptive Computing Systems" pdf

... participation of all nodes, and the limited bandwidth and battery power of nodes. Attacks against MANETs can be classified into two cate- gories: passive attacks and active attacks. Passive attacks ... makes attack paths change frequently. Therefore, additional con- straints are placed on tracing approaches for locating the attack sources in time. Therefore, the traceback approaches 8 EURASI...

Ngày tải lên: 22/06/2014, 22:20

... was amplified by two rounds of PCR using semi-nested primers. The primer set BG1 (TATGGTGGGAGAAGAAATTAGTAAAGG) and BG2 (AATAACCTTATCCTCCTCTATAAAATAACC) were used in the first round and BG2 and ... were prepared for high performance liquid chromatograp hy (HPLC) analysis of globin chain expression and DNA was isolated for bisulfite sequence analysis. Baboon Treatments Two baboons (P. anubi...

Ngày tải lên: 18/06/2014, 16:20

... Stankovi ´ c and LJ. Stankovi ´ c, “An architecture for the real- ization of a system for time-frequency signal analysis,” IEEE Transactions on Circuits And Systems—Part II: Analog and Dig- ital ... SUB Cin Dataa[] Datab[] Result[] Cout ParADD1 LPM ADD SUB Cin Dataa[] Datab[] Result[] Cout LPM DFF Data[] q[] OutREG Output SM[19 0] a1 [19 0] Figure 12: FPGA schematic diagram of the 8-...

Ngày tải lên: 22/06/2014, 23:20

... 5¢-GGGAATTCCATATGAGAGACAATA TTTCCCGTTTATCAAATC-3¢ and 5¢-CCGCTCGAGT CATTACTAGGTTCCCTGTCCAGTGTTACC-3¢,and PDE1(Lys321–Thr620) was amplified with primers 5¢-GGG AATTCCATATGAAGAATGATCAATCTGGCTGCG GCGCAC-3¢ and 5¢-CCGCTCGAGTCATTACTAGG TTCCCTGTCCAGTGTTACC-3¢. ... parasites as potential targets for antiparasitic drugs. The African trypanosome Trypanosoma brucei is the protozoon that causes the fat...

Ngày tải lên: 19/02/2014, 12:20

... Standard for Local and Metropolitan Area Networks Part 16: Air Interface for Fixed Broadband Wireless Access Systems, Amendment 2: Physical and Medium Access Control Layers for Combined Fixed and ... rewritten, and the main approach was also revised with coherence. References [1] “IEEE Standard for Local and Metropolitan Area Networks Part 16: Air Interface for Fixed Broadband Wirel...

Ngày tải lên: 21/06/2014, 17:20

... practical operation of the UMTS system, the capacity is available for all services and only when the system goes to a heavy loaded situation, the capacity reservation will be activated. This also ... Universidad de Cantabria, 39005 Santander, Spain 3 Departamento de Investigaci ´ on y Desarrollo, Grupo Vodafone, 18004 Granada, Spain Correspondence should be addressed to S. Salcedo-Sanz, s...

Ngày tải lên: 21/06/2014, 23:20

... Essen- tially, the goal is to use a language for which named entity recognition software is readily available as a reference for tagging named entities in a language for which such software is not available. ... transcription and a candidate English transliter- ation. The method requires a manual enumeration of the possible transliterations for each katakana sym- bol, which...

Ngày tải lên: 08/03/2014, 02:21

... days and who are admitted to a unit that has high infection rates despite adherence to other strategies, such as maximal barrier precautions and implementation of an educational program. As acceptable incidence ... 1:34 http://www.annalsofintensivecare.com/content/1/1/34 Page 5 of 9 28. Valles J, Fernandez I, Alcaraz D, Chacon E, Cazorla A, Canals M, Mariscal D, Fontanals D, Moron A: Pros...

Ngày tải lên: 21/06/2014, 01:20

... necessary to achieve this in the past but are today still appropriate for a wide range of applications. For instance, 3D cinema applications based on glasses (such as IMAX theatres) are well established. ... wear glasses, but with motion parallax impression and full social interaction. MVD can serve as a generic format for 3DV in this concept as it has clear advantages over alternat...

Ngày tải lên: 22/06/2014, 00:20

... 1995. [4] Q. Jiang and C L. Tang, “Periodic and subharmonic solutions of a class of subquadratic second- order Hamiltonian systems,” Journal of Mathematical Analysis and Applications, vol. 328, ... 3263–3270, 1998. [6] C L. Tang and X P. Wu, “Periodic solutions for a class of nonautonomous subquadratic second order Hamiltonian systems,” Journal of Mathematical Analysis and Applications,...

Ngày tải lên: 22/06/2014, 19:20