Báo cáo hóa học: " ZSBT: A Novel Algorithm for Tracing DoS Attackers in MANETs" pot

... remote attacker in MANETs. In this paper, we proposed a zone sampling-based traceback (ZSBT) algorithm for tracing DoS attackers in MANETs. In our algorithm, when a node forwards a packet, the node ... arbitrarily, which makes attack paths change frequently. Therefore, additional con- straints are placed on tracing approaches for locating the attack sources in t...

Ngày tải lên: 22/06/2014, 22:20

... to take into account, fast fading margin, log-normal fading margin, and the interference margin, M i . This interference margin is a very relevant value, because it measures the maximum interference ... giving encouraging results. An analytical algorithm is also proposed and compared with the iterative heuristic. Finally, a combination of both algorithms is also tested, where the analyt...

Ngày tải lên: 21/06/2014, 23:20

... was amplified by two rounds of PCR using semi-nested primers. The primer set BG1 (TATGGTGGGAGAAGAAATTAGTAAAGG) and BG2 (AATAACCTTATCCTCCTCTATAAAATAACC) were used in the first round and BG2 and ... DeSimone 1,2 Abstract Background: S110 is a novel dinucleoside analog that could have advantages over existing DNA methyltransferase (DNMT) inhibitors such as decitabine. A potential therape...

Ngày tải lên: 18/06/2014, 16:20

... G i . For each logical request group, a parallel video server maintains a stream informa- tion list. Each element of the stream infor mation list records the necessary information of a patching ... have very similar balancing results [24]. However, the random placement scheme only provides probabilistic guarantee of load balancing and it has the drawback of main- taining a huge vide...

Ngày tải lên: 23/06/2014, 01:20

... pressure ventilation for bilateral diaphragm paralysis after pediatric cardiac surgery. Interact Cardiovasc Thorac Surg 2009, 8:171-172. 30. Chin K, Uemoto S, Takahashi K, Egawa H, Kasahara M, Fujimoto ... failure can be lifesaving. Mechanical respiratory support is a critical intervention in many cases of ARF. In recent years, NPPV has been proposed as a valuable alternative to inv...

Ngày tải lên: 21/06/2014, 03:20

... question in the algorithm is how to estimate σ(h i ) since the signal amplitude and noise variance (A and σ) are not known in advance. There are several EURASIP Journal on Advances in Signal Processing ... important feature of nonstationary signals in numerous applications such as radar, sonar, and communications. In this paper, an adaptive algorithm for the chirp-rate estim...

Ngày tải lên: 21/06/2014, 19:20

... SRP- PHAT and MCCC-PHAT have a large evenly distributed like- lihood mass, that is, large variance. Note that only a single talker was active at a time, and the marginal SLFs are multi- modal due ... aspect of local- ization. Large databases of smart room recordings are avail- able for system evaluations and development [1]. A typi- cal ASL system consists of several spatially separ...

Ngày tải lên: 22/06/2014, 00:20

... Estimation, and Modulation Theory: Radar-Sonar Signal Processing and Gaussian Signals in Noise— Part III, John Wiley & Sons, New York, NY, USA, 2nd edition, 2001. [12] A. V. Dandawate and G. B. Giannakis, ... some analytical results are given. In particular, the noise and multipath channel impacts on its values are theoretically analysed. In a second part of the paper, some asymp...

Ngày tải lên: 22/06/2014, 06:20

... Tianjin 300160, China Email address: chenrd@tjpu.edu.cn Y. Yao and R. Chen 7 we have that A is a maximal monotone operator (see Rockafellar [14, Theorem 3]). We can also check that 0 ∈ Av if and ... Mathematical Programming, vol. 87, no. 1, pp. 189–202, 2000. [7] S. Kamimura and W. Takahashi, “Approximating solutions of maximal monotone operators in Hilbert spaces,” Journal of Approxima...

Ngày tải lên: 22/06/2014, 22:20

... Implementation for a W-CDMA Smart Antenna 1385 If capabilities of phased array, switched-beam array, and adaptive array antennas are compared, the last type shows considerable advantages over ... synchronization, DSP, UMTS. 1. INTRODUCTION The smart antenna concept is applied to several kinds of an- tenna arrays. Phased arrays, switched multibeam antennas, and a daptive array antennas a...

Ngày tải lên: 23/06/2014, 01:20