Báo cáo hóa học: "Modification of alumina matrices through chemical etching and electroless deposition of nano-Au array for amperometric sensing" pot

Báo cáo hóa học: "Modification of alumina matrices through chemical etching and electroless deposition of nano-Au array for amperometric sensing" pot

Báo cáo hóa học: "Modification of alumina matrices through chemical etching and electroless deposition of nano-Au array for amperometric sensing" pot

... (2007) 2:130–134 133 123 NANO EXPRESS Modification of alumina matrices through chemical etching and electroless deposition of nano-Au array for amperometric sensing Ar " unas Jagminas Æ Julijana ... the bottom of the pores can be attained through step-wise decrease of anodizing voltage, several steps of chemical etching and electroless depositi...

Ngày tải lên: 22/06/2014, 22:20

5 180 0
Báo cáo hóa học: " Modification of Conductive Polymer for Polymeric Anodes of Flexible Organic Light-Emitting Diodes" pdf

Báo cáo hóa học: " Modification of Conductive Polymer for Polymeric Anodes of Flexible Organic Light-Emitting Diodes" pdf

... resistance of 120 ohm/h) were fabricated for reference. The TPD, Alq 3 , LiF, and Al films were deposited under a vacuum of 2 9 10 -6 Torr with a deposition rate of 0.5, 0.2, 0.3, and 0.5 nm/s, respectively. ... from PSS and PEDOT. At a take-off angle of 45°, the pristine and the modified PEDOT:PSS films exhibit no difference. On the contrast at a take-off angle of 25°, the...

Ngày tải lên: 22/06/2014, 00:20

5 363 0
Báo cáo hóa học: " cDNA targets improve whole blood gene expression profiling and enhance detection of pharmocodynamic biomarkers: a quantitative platform analysis" ppt

Báo cáo hóa học: " cDNA targets improve whole blood gene expression profiling and enhance detection of pharmocodynamic biomarkers: a quantitative platform analysis" ppt

... included the down regu- lation of MYC and up regulation of GADD45B [24]. Conclusions Blood is a critical tissue for the understanding of disease and the development of disease treatments. It is ... analysis of PNA and no treatment samples. The number of signifi- cant genes differentially regulated between 1% liver and 1% brain is equal to 97 for no treatment, 117 for...

Ngày tải lên: 18/06/2014, 16:20

12 585 0
báo cáo hóa học: " Differential aquaporin 4 expression during edema build-up and resolution phases of brain inflammation" doc

báo cáo hóa học: " Differential aquaporin 4 expression during edema build-up and resolution phases of brain inflammation" doc

... Isoform 1: NM_012825.3 Sens: TTGGACCAATCATAGGCGC 770 to 788 Isoform 1 213 pb 98.2% 778 to 796 Isoform 2 Isoform 2: NM_001142366.1 Revs: GGTCAATGTCGATCACATGC 963 to 982 Isoform 1 971 to 990 Isoform ... performed against AQP4, ED1 and Iba1 (for macrophages and microglia), IgG (for serum protein accumulation secondary to BBB alteration) and GFAP (for astrocytes). Immunostaining For im...

Ngày tải lên: 19/06/2014, 22:20

16 393 0
Báo cáo hóa học: " Research Article A Hajek-Renyi-Type Maximal Inequality and ´ ´ Strong Laws of Large Numbers for " doc

Báo cáo hóa học: " Research Article A Hajek-Renyi-Type Maximal Inequality and ´ ´ Strong Laws of Large Numbers for " doc

... maximal inequality for multidimensional arrays of random elements and some maximal moment inequalities for arrays of dependent random elements. Journal of Inequalities and Applications 3 The paper is ... n ∈ d } be an array of nonnegative real numbers, let {b n , n ∈ d } be an array of positive real numbers satisfying 1.5 and b n →∞as n →∞,andlet{X n , n ∈ d } be an...

Ngày tải lên: 21/06/2014, 07:20

14 403 0
báo cáo hóa học:" A conditional-lethal vaccinia virus mutant demonstrates that the I7L gene product is required for virion morphogenesis" potx

báo cáo hóa học:" A conditional-lethal vaccinia virus mutant demonstrates that the I7L gene product is required for virion morphogenesis" potx

... Dr. Paula Traktman for the vTetR virus strain and for help- ful discussions, Tove' Bolken and Dr. Marika Hedengren-Olcott for helpful discussions, and Dr. Michael Nesson for the electron ... at an MOI of 1 in the presence (panels A, B, and C) of 10 µg/ml TET or in the absence (panels D, E, and F) of TET. Cells were harvested at 24 hpi, immediately fixed and p...

Ngày tải lên: 20/06/2014, 04:20

6 208 0
Báo cáo hóa học: " Verification and Validation of a Fingerprint Image Registration Software" pptx

Báo cáo hóa học: " Verification and Validation of a Fingerprint Image Registration Software" pptx

... inter- ests include software V&V, combining for- mal methods and testing, and software reli- ability analysis and estimation. Vijai Gandikota rece ived the B.E. degree in electronics and communications ... transformation of interest (it is equivalent to transform the source image and compare it with the reference image, or to apply inverse transformation to the reference ima...

Ngày tải lên: 22/06/2014, 23:20

9 358 0
Báo cáo hóa học: " Robust TLR4-induced gene expression patterns are not an accurate indicator of human immunity" ppt

Báo cáo hóa học: " Robust TLR4-induced gene expression patterns are not an accurate indicator of human immunity" ppt

... Song-Zhao, and Aaron Hirschfeld for technical support, and the patient and his family for their cooperation. Author details 1 Centre for Microbial Diseases and Immunity Research, Department of Microbiology ... the conception and design of the clinical and animal experiments. DPS and REWH were imperative to the conception, design and implementation of the experiment...

Ngày tải lên: 18/06/2014, 16:20

12 698 0
Báo cáo hóa học: " Transcriptional responses in the adaptation to ischaemia-reperfusion injury: a study of the effect of ischaemic preconditioning in total knee arthroplasty patients" docx

Báo cáo hóa học: " Transcriptional responses in the adaptation to ischaemia-reperfusion injury: a study of the effect of ischaemic preconditioning in total knee arthroplasty patients" docx

... work including the extraction of RNA, validation of microarray data by real-time PCR and the analysis of serum samples. The microarray experiment and the analysis of array data were carried out ... at the onset of surgery allowed for the identification of changes resulting from the precondition- Table 1: Forward and reverse primers used for real-time PCR validation o...

Ngày tải lên: 18/06/2014, 16:20

11 617 0
báo cáo hóa học: " How do medical students value health on the EQ-5D? Evaluation of hypothetical health states compared to the general population" ppt

báo cáo hóa học: " How do medical students value health on the EQ-5D? Evaluation of hypothetical health states compared to the general population" ppt

... pain/discomfort and anxiety/depression (chi 2 - Test: p < .01; Table 3) Valuation of hypothetical health states The mean VAS scores for the 10 health hypothetical states ranged from 0.815 for the ... to complement other forms of quality of life measures. It has been purposefully developed to generate a cardinal index of health, therefore it has considerable potential for us...

Ngày tải lên: 18/06/2014, 19:20

6 423 0
w