Báo cáo hóa học: " Miniband-related 1 4–1 8 lm luminescence of Ge/Si quantum dot superlattices" potx

Báo cáo hóa học: " Research Article On the (p, q)-Boundedness of Nonisotropic Spherical Riesz Potentials" potx

Báo cáo hóa học: " Research Article On the (p, q)-Boundedness of Nonisotropic Spherical Riesz Potentials" potx

... out: 1 ≤ p ≤ r ≤∞, 1 − 1/ p +1/ r = 1/ q, f ∈ L p (Ω 1 n,λ ). Then   J λ   L p (Ω 1 n,λ ) ≤   f   L r (Ω 2 n,λ ) k 1 k 2 . (1. 9) Proof. Let λ, μ, ν be positive numbers such that 1/ λ +1/ μ +1/ ν = ... a way 1 λ =  1 p − 1 μ  , 1 λ =  1 q − 1 ν  , 1 λ = 1 r . (1. 12) With these choices of λ, μ and ν, we can rewrite expression last inequality, J λ (x)...

Ngày tải lên: 22/06/2014, 18:20

8 365 0
báo cáo hóa học: " 5-aminoimidazole-4-carboxamide-1-beta-4-ribofuranoside (AICAR) attenuates the expression of LPS- and Aβ peptide-induced inflammatory mediators in astroglia" pptx

báo cáo hóa học: " 5-aminoimidazole-4-carboxamide-1-beta-4-ribofuranoside (AICAR) attenuates the expression of LPS- and Aβ peptide-induced inflammatory mediators in astroglia" pptx

... functions of AICAR suggest it as a viable candidate for use in treatment of Alzheimer's disease. Published: 20 September 2005 Journal of Neuroinflammation 2005, 2: 21 doi :10 .11 86 /17 42-2094-2- 21 Received: ... production of cytokines TNF-α, IL -1 , IL-6 and nitric oxide (NO) in glial cells, Journal of Neuroinflammation 2005, 2: 21 http://www.jneuroinflammation.com/conte...

Ngày tải lên: 19/06/2014, 22:20

21 467 0
Báo cáo hóa học: "Programmed cell death-1 (PD-1) at the heart of heterologous prime-boost vaccines and regulation of CD8+ T cell immunity" doc

Báo cáo hóa học: "Programmed cell death-1 (PD-1) at the heart of heterologous prime-boost vaccines and regulation of CD8+ T cell immunity" doc

... ther 2009, 20 : 18 1-9. doi :10 .11 86 /14 79- 587 6 -8 -13 2 Cite this article as: Bot et al.: Programmed cell death -1 (PD -1) at the heart of heterologous prime-boost vaccines and regulation of CD8 + T cell ... refs [40,42, 48, 59,60]). Bot et al. Journal of Translational Medicine 2 010 , 8 :13 2 http://www.translational-medicine.com/content /8 /1/ 132 Page 8 of 11 primar...

Ngày tải lên: 18/06/2014, 16:20

11 506 0
báo cáo hóa học: " Hypoxia-inducible factor-1 (HIF-1) is involved in the regulation of hypoxia-stimulated expression of monocyte chemoattractant protein-1 (MCP-1/CCL2) and MCP-5 (Ccl12) in astrocytes" pdf

báo cáo hóa học: " Hypoxia-inducible factor-1 (HIF-1) is involved in the regulation of hypoxia-stimulated expression of monocyte chemoattractant protein-1 (MCP-1/CCL2) and MCP-5 (Ccl12) in astrocytes" pdf

... means). HIF -1 HIF -1 shift 1 2 3 4 5 6 7 8 9 10 11 12 13 14 HIF -1 HIF -1 D +/+ HIF -1 D +/- HIF -1 D +/+ HIF -1 D +/- C H Co C H Co C H Co C H Co H H Wild-type HIF -1 probe Mutant HIF -1 probe Treatment Cells Probe HIF -1 D +/+ wt HIF -1 D antibody -+ A) B) CHCHCH 0 50 10 0 15 0 200 250 300 pGL3 pGL3/MCP1w pGL3/MCP1m * Luciferase ... molecular physiology of oxygen h...

Ngày tải lên: 19/06/2014, 22:20

15 541 0
Báo cáo hóa học: " ICP0 antagonizes Stat 1-dependent repression of herpes simplex virus: implications for the regulation of viral latency" potx

Báo cáo hóa học: " ICP0 antagonizes Stat 1-dependent repression of herpes simplex virus: implications for the regulation of viral latency" potx

... 0.04% (12 ) 10 – 20% ( 612 2) 0 .1 – 0.3% (82 ) 18 – 36% (10 89 7) stat1 -/- 0.03 – 0.06% ( 18 ) 10 – 20% (59 78) 0 .1 – 0.2% ( 48) > 20% (TNTC) e rag2 -/- stat1 -/- 0.02 – 0.04% (11 ) 8 – 17 % (5005) 0 .1 – ... Day 14 e Viral genomes per TG f Strain 12 9 KOS 2 × 10 5 10 0% (n = 15 ) 11 /16 14 /16 3.0 × 10 5 Strain 12 9 0 - -GFP 2 × 10 5 10 0% (n = 15 ) 0 /16 0 /...

Ngày tải lên: 20/06/2014, 01:20

23 413 0
Báo cáo hóa học: " Glycerol conversion to 1, 3-Propanediol is enhanced by the expression of a heterologous alcohol dehydrogenase gene in Lactobacillus reuteri" ppt

Báo cáo hóa học: " Glycerol conversion to 1, 3-Propanediol is enhanced by the expression of a heterologous alcohol dehydrogenase gene in Lactobacillus reuteri" ppt

... Klebsiella pneumoniae for bioconversion of glycerol into 1, 3-propanediol. Appl Microbiol Biotechnol 87 : 217 7– 2 18 4. doi :10 .10 07/s00253- 010 -26 78- 0. doi :10 .11 86 / 219 1- 085 5 -1- 37 Cite this article as: Vaidyanathan ... Microbiology 14 2 :12 73 12 79. doi :10 .10 99 /13 50 087 2 -14 2-5 -12 73. Biebl H, Menzel K, Zeng AP, Deckwer WD (19 99) Microbial production of 1, 3...

Ngày tải lên: 20/06/2014, 23:20

8 400 0
báo cáo hóa học: " Differential aquaporin 4 expression during edema build-up and resolution phases of brain inflammation" doc

báo cáo hóa học: " Differential aquaporin 4 expression during edema build-up and resolution phases of brain inflammation" doc

... Location of amplicon Amplicon length Efficiency AQP4 Isoform 1: NM_ 012 82 5.3 Sens: TTGGACCAATCATAGGCGC 770 to 788 Isoform 1 213 pb 98. 2% 7 78 to 796 Isoform 2 Isoform 2: NM_0 011 42366 .1 Revs: GGTCAATGTCGATCACATGC ... 982 Isoform 1 9 71 to 990 Isoform 2 GFAP NM_ 017 009.2 Sens: GCGGCTCTGAGAGAGATTCG 692 to 711 90 pb 10 2.0% Revs: TGCAAACTTGGACCGATACCA 7 61 to 7 81 IL1b NM_0...

Ngày tải lên: 19/06/2014, 22:20

16 393 0
báo cáo hóa học:" CXC receptor-4 mRNA silencing abrogates CXCL12induced migration of colorectal cancer cells" doc

báo cáo hóa học:" CXC receptor-4 mRNA silencing abrogates CXCL12induced migration of colorectal cancer cells" doc

... Med 19 96, 18 4 :11 01- 110 9. 7. Kim CH, Pelus LM, White JR, Broxmeyer HE: Differential chemotactic behavior of developing T cells in response to thymic chemokines. Blood 19 98, 91: 4434-4443. 8. Kucia ... Neoplasia 2009, 11 :6 51- 6 61. doi :10 .11 86 /14 79- 587 6-9-22 Cite this article as: Rubie et al.: CXC receptor-4 mRNA silencing abrogates CXCL12-induced migration of colore...

Ngày tải lên: 20/06/2014, 03:20

14 410 0
Báo cáo hóa học: " Scalable MPEG-4 Encoder on FPGA Multiprocessor SOC" pptx

Báo cáo hóa học: " Scalable MPEG-4 Encoder on FPGA Multiprocessor SOC" pptx

... (subfunction) 1 slave CPU 2 slave CPUs 3 slave CPUs Merge 3 287 6. 415 0 380 09 .87 50 4 316 0.7267 Config 28 21. 6367 5 313 .83 33 787 8 .84 50 GetBitStreamSize 12 64.2967 2 517 .6 617 3772.6450 Oth 11 7 016 .7367 11 7465.5550 11 7 982 .0 483 0 0.5 1 1.5 2 2.5 3 3.5 Normalized ... 12 64.2967 Oth 0.00 41 0.9959 11 7 016 .7367 0 10 20 30 40 50 60 70 80 90 10 0 11 0 12 0 13...

Ngày tải lên: 22/06/2014, 22:20

15 266 0
w