Báo cáo hóa học: " Strain Relief Analysis of InN Quantum Dots Grown on GaN ´ ´ Juan G Lozano Æ Ana M Sanchez Æ Rafael Garcıa Æ ´ Sandra Ruffenach Æ Olivier Briot Æ David Gonzalez" pot

Báo cáo hóa học: " Strain Relief Analysis of InN Quantum Dots Grown on GaN ´ ´ Juan G. Lozano Æ Ana M. Sanchez Æ Rafael Garcıa Æ ´ Sandra Ruffenach Æ Olivier Briot Æ David Gonzalez" pot

Báo cáo hóa học: " Strain Relief Analysis of InN Quantum Dots Grown on GaN ´ ´ Juan G. Lozano Æ Ana M. Sanchez Æ Rafael Garcıa Æ ´ Sandra Ruffenach Æ Olivier Briot Æ David Gonzalez" pot

... Conclusions In summary, we have estimated the degree of plastic relaxation in individual InN quantum dots on GaN using moire ´ fringe analysis and Fourier filtered HRTEM images. This ... Planar view TEM can give a more complete charac- terization, but in high misfit systems such as InN/ GaN the Fig. 1 PVTEM micrograph of an InN quantum dot showing three sets of tran...

Ngày tải lên: 22/06/2014, 18:20

5 240 0
Báo cáo hóa học: " Single-dot Spectroscopy of GaAs Quantum Dots Fabricated by Filling of Self-assembled Nanohole" docx

Báo cáo hóa học: " Single-dot Spectroscopy of GaAs Quantum Dots Fabricated by Filling of Self-assembled Nanohole" docx

... highly interesting since they represent a novel path for entangled photon generation using the time reordering scheme [26]. Conclusions In conclusion, we have studied a novel type of strain- free GaAs quantum ... distributed under the terms of the Creative Commons Attribution Noncommercial License which per- mits any noncommercial use, distribution, and reproduction in any medium, prov...

Ngày tải lên: 21/06/2014, 17:20

4 241 0
Báo cáo hóa học: "Microrna profiling analysis of differences between the melanoma of young adults and older adults" pot

Báo cáo hóa học: "Microrna profiling analysis of differences between the melanoma of young adults and older adults" pot

... 2009, 106(13):5330-5335. 71. Panelli MC, Wang E, Phan G, Puhlmann M, Miller L, Ohnmacht GA, Klein HG, Marincola FM: Gene-expression profiling of the response of peripheral blood mononuclear cells and melanoma metastases ... http://www.mir2disease. org/ The Melanoma Molecular Map project http://www. mmmp.org/MMMP/ is a multiinteractive data base for research on melanoma biology and tre...

Ngày tải lên: 18/06/2014, 16:20

23 543 0
báo cáo hóa học:" Site-specific analysis of gene expression in early osteoarthritis using the Pond-Nuki model in dogs" pot

báo cáo hóa học:" Site-specific analysis of gene expression in early osteoarthritis using the Pond-Nuki model in dogs" pot

... ACACTCTACCACTGGCATCC 196 83.5 RC GCTACTTGTTGTACTGCAGC MMP-1 FOR CCTAGAACCGTGAAGAGCAT 150 80 RC CAGGAAAGTCAGCTGCTATC MMP 3 FOR ATGGCATCCAGTCCCTGTAT 161 86.5 RC AAAGAACAGGAACTCTCCCC MMP 13 FOR TCTGGTCTTCTGGCTCATGC ... TCTGGTCTTCTGGCTCATGC 141 82.7 RC GGTCAAGACCTAAGGAGTGG ADAMTS4 FOR CATCACTGAGTTCCTGGACA 106 84.5 RC CGATCAGCGTCATAGTCCTT ADAMTS5 FOR TGACTTCTTGCATGGCATGG 120 81.5 RC CTGGCATGGCTGGT...

Ngày tải lên: 20/06/2014, 00:20

12 522 0
Báo cáo hóa học: " Quantitative expression analysis of HHV-6 cell receptor CD46 on cells of human cord blood, peripheral blood and G-CSF mobilised leukapheresis cells" docx

Báo cáo hóa học: " Quantitative expression analysis of HHV-6 cell receptor CD46 on cells of human cord blood, peripheral blood and G-CSF mobilised leukapheresis cells" docx

... Hara T, Matsumoto M, Akedo H: Quantitative analysis of membrane cofactor protein (MCP) of complement. High expression of MCP on human leukemia cell lines, which is down- regulated during cell ... m. S. Onkologie/Hämatologie, Charitéplatz 1, 10117 Berlin, Germany, 2 Charité-Universitätsmedizin Berlin, CCM – Medizinische Klinik m. S. Onkologie/Hämatologie, Charitéplatz 1, 10117 Be...

Ngày tải lên: 20/06/2014, 01:20

4 272 0
báo cáo hóa học:" Probability distribution analysis of M-QAM-modulated OFDM symbol and reconstruction of distorted data" potx

báo cáo hóa học:" Probability distribution analysis of M-QAM-modulated OFDM symbol and reconstruction of distorted data" potx

... analysis of M- QAM-modulated OFDM symbol and reconstruction of distorted data Hyunseuk Yoo ∗ , Fr´ed´eric Guilloud and Ramesh Pyndiah Department of Signal and Communications, Telecom Bretagne, Technopole ... article, we analyze the exact PD of M- QAM/OFDM symbols with N subcarriers. We show the general expression of the characteristic function of the time domain samples of...

Ngày tải lên: 20/06/2014, 04:20

20 435 0
báo cáo hóa học:" Eco-epidemiological analysis of dengue infection during an outbreak of dengue fever, India" pdf

báo cáo hóa học:" Eco-epidemiological analysis of dengue infection during an outbreak of dengue fever, India" pdf

... the temperature during the last month of pre monsoon; May and beginning of monsoon in the June. Unusual heavy rainfall subsequently led to decrease in temperature dur- ing the later part of monsoon ... during the pre monsoon and post monsoon period as compared to the monsoon period. Even though, the monsoon season began in mid- June, there was no res- pite from the heat as there was not...

Ngày tải lên: 20/06/2014, 04:20

7 228 0
báo cáo hóa học:" The biomechanical analysis of three plating fixation systems for periprosthetic femoral fracture near the tip of a total hip arthroplasty" docx

báo cáo hóa học:" The biomechanical analysis of three plating fixation systems for periprosthetic femoral fracture near the tip of a total hip arthroplasty" docx

... stable). The goals of treatment for a periprosthetic femur frac- ture at the tip of a femoral stem include successful frac- ture union while maintaining longterm implant survival. The most common approach ... in the med- ullary canals. Right femora served as matched intact con- trols, since management of periprosthetic femur fractures may be improved by using fixation systems with equal...

Ngày tải lên: 20/06/2014, 04:20

8 336 0
Báo cáo hóa học: " Delay-throughput analysis of multi-channel MAC protocols in ad hoc networks" ppt

Báo cáo hóa học: " Delay-throughput analysis of multi-channel MAC protocols in ad hoc networks" ppt

... arrival rate g = 0.04. With these parameters, G- McMAC offers the highest throughput regardless of the amount of channels and once again, MMAC gives con- stant throughput due to the short ATIM window. ... discrete time slots and assume fixed packet sizes along with perfect time synchroniza- tion among the nodes. The length of a time slot τ is defined to correspond to the maximum pro...

Ngày tải lên: 20/06/2014, 22:20

15 345 0
Từ khóa:
w