Salmonella A Dangerous Foodborne Pathogen Part 17 doc

... CTC ACC AGG AGA TTA CAA CAT GG Malorny et al., 2004 minced meat 2: AGC TCA GAC CAA AAG TGA CCA TC fish 3: CAC CGA CGG CGA GAC CGA CTT T fimC 10 3 CFU/ml 1: ATA AAT ... 1: CATTGATGCCATGGGTGACART 2: CGTGACGATAATCCGTGTAC 3: TACACGAGTCACTAAATCCTTCAGT (Set II) Table 3. Detection of Salmonella using real-time PCR.increase of the released dye concentrat...

Ngày tải lên: 22/06/2014, 04:20

... L-LACTATE alkalinisation; AGLU: ALPHA- GLUCOSIDASE; SUCT: SUCCINATE alkalinisation; NAGA: Beta-N-NCETYL-GALACTOSAMINIDASE; AGAL: ALPHA-GALACTOSIDASE; PHOS: PHOSPHATASE; GlyA: Glycine ARYLAMIDASE; ... Marmara The Istanbul Strait connects the Sea of Marmara to the Black Sea and the Canakkale Strait to the Aegean Sea. The Sea of Marmara separates Turkey’s Asian and European regions. Being an...

Ngày tải lên: 22/06/2014, 04:20

... http://seafood.ucdavis.edu/haccp/compendium/chapt17.htm 06.06.2011 Shabarinath, S.; Kumar, H. S.; Khushiramani, R.; Karunasagar, I. & Karunasagar, I. (2007). Detection and Characterization of Salmonella Associated with Tropical ... sanitation (Dalsgaard, 1998). Salmonella in Fish and Fishery Products 97 Salmonella Serotype India/ SE Asia Africa Central America Central...

Ngày tải lên: 22/06/2014, 04:20

... Universidade Estadual Paulista “Júlio de Mesquita Filho”, Araraquara/SP. Nascimento, H.M.; D .A. Delado; I.F. Barbaric. Avaliação da aplicação de agentes sanitizantes como controladores do ... first Salmonellas has been found also continues recently. When Salmonella bacteria are examined by DNA/DNA hybridization trials which are performed among bacteria, all Salmonellas should be accep...

Ngày tải lên: 22/06/2014, 04:20

... precipitated area (Figure 5). Fig. 5. Appearance of typical Salmonella colonies in Mac Conkey agar 5.1.3.3 Appearance of Salmonella colonies in Salmonella – Shigella agar (SS) Typical Salmonella ... Brillantgreen Sulphadiazine agar Brillant Green Mac Conkey agar Desoksicholate Citrate agar Salmonella -Shigella Agar,(SS) Bismuth Sulphite agar EMB AGAR ENDO AGAR Samples ar...

Ngày tải lên: 22/06/2014, 04:20

... p.1383-1390. Salmonella – A Dangerous Foodborne Pathogen 192 sanitation, nutrition and immunization, has lead to a dramatic decrease in deaths and a major gain in human life expectancy (WHO, ... Ecologia e prevalência de Salmonella spp. em aves e material avícola no Brasil. (2005). In: Conferência Apinco de Ciência e Tecnologia Avícolas, 2005, Santos, SP. Anais , Camp...

Ngày tải lên: 22/06/2014, 04:20

... Hasan et al., 2009 Senegal Chicken Carcasses and Street-Vended Restaurants Brancaster, Goelzau, Kentucky, Hadar, Agona, Poona, Bandia, Bessi, Brunei, Hull, Istanbul, Javiana, Magherafelt, ... and farmed animals. Animals may become infected with Salmonella through environmental contamination, other animals or contaminated feed. Both animals and humans can function as Salmonell...

Ngày tải lên: 22/06/2014, 04:20

... we analyze the data regarding the spread of Salmonella among farm animals, we can find out that the importance of Salmonella as a cause of human foodborne disease is decreasing, also thanks ... Niehaus, A. J., Apalata, T., Coovadia, Y.M., Smith, A. M. & Moodley, P. (2011). An outbreak of foodborne salmonellosis in rural KwaZulu-Natal, South Africa, Foodborne Pathogens a...

Ngày tải lên: 22/06/2014, 04:20

... Salmonella Paratyphi A, B and C, agents of typhoid fever; highly adapted to animals: Salmonella Dublin (bovines), Salmonella Choleraesuis and Salmonella Typhisuis (swine), Salmonella Pullorum and Salmonella ... salamae (513); Salmonella enterica subsp arizonae (100); Salmonella enterica subsp diarizonae (341); Salmonella enterica subsp 9 Important Aspects of Salmonell...

Ngày tải lên: 22/06/2014, 04:20

... 2011 Jan ;17( 1):16-22. Shabarinath, S., H. Sanath Kumar, R. Khushiramani, I. Karunasagar, and I. Karunasagar. 2007. Detection and characterization of Salmonella associated with tropical seafood. ... enteric pathogens (Anadón, Rosa Martínez-Larrañaga, & Aranzazu Martínez, 2006; Boyle et al., 2007; Cartman, La Ragione, & Woodward, 2008; Vila et al., 2009; L. D. Williams, Burdock,...

Ngày tải lên: 22/06/2014, 04:20