Salmonella A Dangerous Foodborne Pathogen Part 9 doc
... Conferencia Apinco de Ciência e Tecnologia Avícolas, 199 6, Curitiba, PR. Anais , Campinas: FACTA, 199 6. p.57 Nakamura, M.; Nagamine, N.; Takashi, T.; Suzuki, S.; Sato, S. ( 199 4). Evaluation of ... of Healthcare- associated MRSA. Atlantaed. Clark, G.M.; Kaukmann, A. F.; Gangarosa, E.J. ( 197 3). Epidemiology of an international outbreak of Salmonella Agona, Lancet, v.2, p. 490 - 493...
Ngày tải lên: 22/06/2014, 04:20
... L-LACTATE alkalinisation; AGLU: ALPHA- GLUCOSIDASE; SUCT: SUCCINATE alkalinisation; NAGA: Beta-N-NCETYL-GALACTOSAMINIDASE; AGAL: ALPHA-GALACTOSIDASE; PHOS: PHOSPHATASE; GlyA: Glycine ARYLAMIDASE; ... Marmara The Istanbul Strait connects the Sea of Marmara to the Black Sea and the Canakkale Strait to the Aegean Sea. The Sea of Marmara separates Turkey’s Asian and European regions. Being an...
Ngày tải lên: 22/06/2014, 04:20
... health and medical subjects No:71, HMSO, London. Salmonella – A Dangerous Foodborne Pathogen 108 Ward, D. & Hart, K. ( 199 7). HACCP: Hazard Analysis and Critical Control Point Training ... bongori and VI. indicates. In 198 7 a proposal was made to change the name Salmonella choleraesuis for Salmonella enterica and in 198 9 the * Corresponding author Salmonel...
Ngày tải lên: 22/06/2014, 04:20
Salmonella A Dangerous Foodborne Pathogen Part 6 docx
... Ciências Farmacêuticas, Universidade Estadual Paulista “Júlio de Mesquita Filho”, Araraquara/SP. Nascimento, H.M.; D .A. Delado; I.F. Barbaric. Avaliação da aplicação de agentes sanitizantes como ... first Salmonellas has been found also continues recently. When Salmonella bacteria are examined by DNA/DNA hybridization trials which are performed among bacteria, all Salmonellas should...
Ngày tải lên: 22/06/2014, 04:20
Salmonella A Dangerous Foodborne Pathogen Part 7 docx
... precipitated area (Figure 5). Fig. 5. Appearance of typical Salmonella colonies in Mac Conkey agar 5.1.3.3 Appearance of Salmonella colonies in Salmonella – Shigella agar (SS) Typical Salmonella ... Brillantgreen Sulphadiazine agar Brillant Green Mac Conkey agar Desoksicholate Citrate agar Salmonella -Shigella Agar,(SS) Bismuth Sulphite agar EMB AGAR ENDO AGAR Samples ar...
Ngày tải lên: 22/06/2014, 04:20
Salmonella A Dangerous Foodborne Pathogen Part 17 doc
... CTC ACC AGG AGA TTA CAA CAT GG Malorny et al., 2004 minced meat 2: AGC TCA GAC CAA AAG TGA CCA TC fish 3: CAC CGA CGG CGA GAC CGA CTT T fimC 10 3 CFU/ml 1: ATA AAT ... 1: CATTGATGCCATGGGTGACART 2: CGTGACGATAATCCGTGTAC 3: TACACGAGTCACTAAATCCTTCAGT (Set II) Table 3. Detection of Salmonella using real-time PCR.increase of the released dye concentrat...
Ngày tải lên: 22/06/2014, 04:20
Salmonella A Dangerous Foodborne Pathogen Part 2 ppt
... Hasan et al., 20 09 Senegal Chicken Carcasses and Street-Vended Restaurants Brancaster, Goelzau, Kentucky, Hadar, Agona, Poona, Bandia, Bessi, Brunei, Hull, Istanbul, Javiana, Magherafelt, ... Thompson, Mbandaka, Agona Lestari et al., 20 09 Salmonella – A Dangerous Foodborne Pathogen 22 Salmonella- infected animals shed the microorganism in the feces from where...
Ngày tải lên: 22/06/2014, 04:20
Salmonella A Dangerous Foodborne Pathogen Part 3 potx
... we analyze the data regarding the spread of Salmonella among farm animals, we can find out that the importance of Salmonella as a cause of human foodborne disease is decreasing, also thanks ... Imported Papayas. In: Salmonella Outbreaks, 20.7.2011, Available from: http://www.cdc.gov /salmonella/ agona-papayas/index.html CDC. (2011)b. Investigation Update: Multistate Outbreak o...
Ngày tải lên: 22/06/2014, 04:20
Salmonella A Dangerous Foodborne Pathogen Part 8 pptx
... Salmonella Paratyphi A, B and C, agents of typhoid fever; highly adapted to animals: Salmonella Dublin (bovines), Salmonella Choleraesuis and Salmonella Typhisuis (swine), Salmonella Pullorum and Salmonella ... Uruguay, Paraguay and Ecuador (Franco et al., 2003). According to the National Health Surveillance Agency in Brazil [ANVISA; Agência Nacional de Vigilância Sanitária],...
Ngày tải lên: 22/06/2014, 04:20
Salmonella A Dangerous Foodborne Pathogen Part 11 pot
... 2011 Jan;17(1):16-22. Shabarinath, S., H. Sanath Kumar, R. Khushiramani, I. Karunasagar, and I. Karunasagar. 2007. Detection and characterization of Salmonella associated with tropical seafood. ... enteric pathogens (Anadón, Rosa Martínez-Larrañaga, & Aranzazu Martínez, 2006; Boyle et al., 2007; Cartman, La Ragione, & Woodward, 2008; Vila et al., 20 09; L. D. Williams, Burdock,...
Ngày tải lên: 22/06/2014, 04:20