Báo cáo hóa học: " Grafting of Poly(methyl methacrylate) Brushes from Magnetite Nanoparticles Using a Phosphonic Acid Based Initiator by Ambient Temperature Atom Transfer Radical Polymerization (ATATRP)" pdf
... Nanoscale Res Lett (2008) 3:109–117 123 NANO EXPRESS Grafting of Poly(methyl methacrylate) Brushes from Magnetite Nanoparticles Using a Phosphonic Acid Based Initiator by Ambient Temperature Atom ... 2008 Abstract Poly(methyl methacrylate) in the brush form is grown from the surface of magnetite nanoparticles by ambient temperature atom...
Ngày tải lên: 21/06/2014, 22:20
... Tan Nanostructured and Biological Materials Branch, Materials and Manufacturing Directorate, AFRL/RXBN, Air Force Research Laboratory, Wright-Patterson Air Force Base, Dayton, OH 45433-7750, USA J B. Baek (&) Ulsan ... as-prepared SWCNTs contain a large amount of impurities such as small-sized catalytic metal particles and carbonaceous materials [3, 4]. They also have difficulty in effi...
Ngày tải lên: 22/06/2014, 00:20
... Yurugi-Kobayashi, Akane Nonoguchi, Yutaka Suzuki, Ting- Hsing Chao, Naoki Sawada, Yasutomo Fukunaga, Kazutoshi Miyashita, Kwijun Park, Naofumi Oyamada, Naoya Sawada, Daisuke Taura, Nao- hisa Tamura, Yasushi ... Kenichi Yama- hara, Takami Yurugi-Kobayashi, Kwijiun Park, Naofumi Oyamada, Naoya Sawada, Daisuke Taura, Hirokazu Tsujimoto, Ting-Hsing Chao, Naohisa Tamura, Masashi Mukoyama, Kazuwa N...
Ngày tải lên: 18/06/2014, 15:20
Báo cáo hóa học: "Detection of carcinoembryonic antigen messenger RNA in blood using quantitative real-time reverse transcriptase-polymerase chain reaction to predict recurrence of gastric adenocarcinoma" potx
... GCAAATGCTTTAAGGAAGAAGC-3’ (antisense). Fluorescent and LC-Red probe sequences used for CEA identification were: 5’-CCTGAAATGAA- GAAACTACACCAGGGC-fluorescein and 5’-L C-Red 640-GCTATATCAGAGCAACCCCAACCAGC- phosphate. Real-time ... circulating breast cancer cells was in a state of apoptosis. In the peripheral blood of cancer Table 4 Multivariate analysis of disease-free survival in gastr...
Ngày tải lên: 18/06/2014, 16:20
báo cáo hóa học: "Impact of gastroesophageal reflux disease on patients'''' daily lives: a European observational study in the primary care setting" doc
... preparation. Data analysis was provided by Astra- Zeneca. All authors read and approved the final submission. Additional material Acknowledgements This study was supported by AstraZeneca. We thank ... fees from AstraZeneca; Dr A. Cooper has no competing interests to declare; Dr D. Karagiannis has received research grants from Abbott and speaker fees from Janssen, AstraZeneca and Fa...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo hóa học: " Classification of rhythmic locomotor patterns in electromyographic signals using fuzzy sets" docx
... n-channel SEMG data as a set of points in n-dimensional space the sums of squares are based on Euclidean distances, whereby each dependent variable has equal weight. This may not always be appropriate. ... statistical analyses. JSW collected the bulk of the data and participated in the data processing. SF contributed to the design of the study, recruitment of subjects, and a...
Ngày tải lên: 19/06/2014, 08:20
báo cáo hóa học: " Effects of the cyclooxygenase-2 inhibitor nimesulide on cerebral infarction and neurological deficits induced by permanent middle cerebral artery occlusion in the rat" potx
... trials and new thera- peutic directions. Stroke 2002, 33:2123-2136. 51. Sasaki T, Kitagawa K, Yamagata K, Takemiya T, Tanaka S, Omura-Mat- suoka E, Sugiura S, Matsumoto M, Hori M: Amelioration of ... made by manually outlining the margins of infarcted areas. The unstained area of the fixed brain section was defined as infarcted. Cortical and subcortical uncorrected infarcted areas and...
Ngày tải lên: 19/06/2014, 22:20
báo cáo hóa học: " Initiation of health-behaviour change among employees participating in a web-based health risk assessment with tailored feedback" pptx
... electronically transferred to the central HRA database. For system security and data protection reasons personal identification data and risk assessment data are stored on separate servers. An electronic ... NIPED as head of the research department and part-time employed at the Academic Medical Center - University of Amsterdam as assistant professor. All other authors are employed by th...
Ngày tải lên: 20/06/2014, 00:20
Báo cáo hóa học: " Detection of virus mRNA within infected host cells using an isothermal nucleic acid amplification assay: marine cyanophage gene expression within Synechococcus sp" doc
... TCGTCTTCCGGTCTCTCCTCT CAAGCCTCAGCGCTCTCTCTC CCTATAGTGAGTCGTATTAATT TCGAAhACGTGACATTACATCA CGCAAGTATTGTTx TCGTCTTCCGGTCTCTCCTCTCA AGCCTCAGCGCTCTCTCTCCCT ATAGTGAGTCGTATTAATTTCGA AhACAGAAACAAGCTTGTTTACG ATGGTCAAx Facilitator 1 TGCTTTTTATCATCACGAATC TCTCCTGTTx ATGTTGGTAATCTACCAAAGGTA AAGGCAGx Facilitator 2 CTGCCTTTACCTTTGGTAGA TTACCAACAx ACAGGAGAGATTCGTGATGATAA AAAGCATx All ... TGACCATCGTAAACAAGC...
Ngày tải lên: 20/06/2014, 01:20