A Development of Novel Integral Method for Prediction of Distorted Inlet Flow Propagation 2 docx
A Development of Novel Integral Method for Prediction of Distorted Inlet Flow Propagation_2 docx
... total pressure ratio versus inlet flow angle Chapter 4 A Development of Novel Integral Method 96 Figure 4.16 indicates that a smaller inlet flow angle causes a higher total pres- sure ratio, ... different inlet sizes of distorted region in a single plot as shown in Fig. 4.14 and Fig. 4.15. Both figures Chapter 4 A Development of Novel Integral M...
Ngày tải lên: 21/06/2014, 21:20
Báo cáo khoa học: A new and efficient method for inhibition of RNA viruses by DNA interference pptx
... siDNA was obtained by hybridization of sense strand (5¢-GTTGCTCTGGAAAACTCATTT-3¢) and anti- sense strand (5¢-ATGAGTTTTCCAGAGCAACTT-3¢), and siRNA was synthesized using DNA templates (sense strand, 5¢-AAATGAGTTTTCCAGAGCAACCCTGTCTC-3¢; ... strand, 5¢-AAATGAGTTTTCCAGAGCAACCCTGTCTC-3¢; anti- sense strand, 5¢-AAGTTGCTCTGGAAAACTCATCCTG TCTC-3¢) and a Silencer siRNA Construction Kit (Ambion). Ac...
Ngày tải lên: 16/03/2014, 02:20
Báo cáo khoa học: "The efficacy of preoperative PET/CT for prediction of curability in surgery for locally advanced gastric carcinoma" ppsx
... gastric cancer. Gastric Cancer 20 05, 8:1-5. 25 . Yoshioka T, Yamaguchi K, Kubota K, Saginoya T, Yamazaki T, Ido T, Yamaura G, Takahashi H, Fukuda H, Kanamaru R: Evaluation of 18F-FDG PET in patients ... correlates of resectability and survival in gastric carcinoma. Ann Surg 1978, 188:711-715. 24 . Saka M, Mudan SS, Katai H, Sano T, Sasako M, Maruyama K: Pancreaticoduodenectomy for a...
Ngày tải lên: 09/08/2014, 03:22
A novel interval method for validating state enclosures of the
... Fast Interval Library,” Computing, vol. 53, pp. 27 7 28 7, 1994. [22 ] C. Bendsten and O. Stauning, “FADBAD, a Flexible C++ Package for Automatic Differentiation Using the Forward and Backward Methods,” ... uncertainties originate from the fact that in almost all practical situations only conservative bounds for the range of these values are available. Throughout this article, 8 m...
Ngày tải lên: 12/01/2014, 22:04
Báo cáo y học: "Development of a Highly Sensitive Method for Detection of JAK2V617F" docx
... P2 (CCTCAGAACGTTGATGGCA) and P2r (ATTGCTTTCCTTTTTCACAA GA) and allele- specific primer s Pnf (AGCATTTGGTTTTAAATTATG- GAGTATATG) and Pmr (GTTTTACTTACTCTCGT CTCCACAAAA). The PCR was run for 35 cycles ... P, Pardanani A, Tefferi A: Clinical correlates of JAK2V617F presence or allele burden in myeloproliferative neoplasms: a critical reappraisal. Leukemia 20 08, 22 : 129 9-1307. 36. Par...
Ngày tải lên: 10/08/2014, 21:23
a rapid method for estiminating of noise expouse workplace
... School of Public Health and Center for Health Research, Hamadan University of Medical Sciences, Iran. **Dept. of Occupational Health, School of Public Health, Hamadan University of Medical Sciences, ... Golmohammadi R et al: A Rapid Method for 22 Classification of workplaces based on noise pollution is one of the necessaries for macro programming view of monito...
Ngày tải lên: 05/09/2013, 13:23
Báo cáo khoa học: "A Nonparametric Method for Extraction of Candidate Phrasal Terms" docx
... 605–613, Ann Arbor, June 20 05. c 20 05 Association for Computational Linguistics A Nonparametric Method for Extraction of Candidate Phrasal Terms Paul Deane Center for Assessment, Design and Scoring ... Annual Meeting of the Association for Computational Linguistics, pages 188-195. Ferreira da Silva, J. and G. Pereira Lopes (1999). A local maxima method and a fai...
Ngày tải lên: 08/03/2014, 04:22
Báo cáo khoa học: "A Part of Speech Estimation Method for Japanese Unknown Words using a Statistical Model of Morphology and Context" pptx
... katakana katakana-kanji kanji-hiragana hiragana kanji-katakana kat akana-symbol-katakana number kanji-hiragana-kanji alphabet kanji-hir agana-kanji-hir agana hiragana-kanji percent 45.1% ... there are at least five different types of characters other than punc- tuation marks: kanji, hiragana, katakana, Roman alphabet, and Arabic numeral. Kanji which means 'Chinese char...
Ngày tải lên: 23/03/2014, 19:20
Báo cáo hóa học: " A relaxed hybrid steepest descent method for common solutions of generalized mixed equilibrium problems and fixed point problems" potx
... chaichana. j@rmutr.ac.th 2 Department of Mathematics, Faculty of Liberal Arts, Rajamangala University of Technology Rattanakosin (Rmutr), Bangkok 10100, Thailand Full list of author information is available at ... Thailand 2 Department of Mathematics, Faculty of Liberal Arts, Rajamangala University of Technology Rattanakosin (Rmutr), Bangkok 10100, Thailand 3 Centre of Exc...
Ngày tải lên: 21/06/2014, 01:20
báo cáo hóa học:" Research Article A Reinforcement Learning Based Framework for Prediction of Near Likely Nodes in Data-Centric Mobile Wireless Networks" pdf
... energy-efficient data dissemination and organization for the increasing amount of wireless data. One of the approaches in data-centric storage is that the nodes that collected data will transfer their data to ... divergence Trace-based, small dataset 300 Trace-based, large dataset 300 Point-based, small dataset 300 Point-based, large dataset 300 (a) Transmission range 300 m 0 0.1 0 .2 0...
Ngày tải lên: 21/06/2014, 18:20