Báo cáo hóa học: "Size-Selected Ag Nanoparticles with Five-Fold Symmetry" potx

... on hemisphere-damaged patients with cerebral focal lesions. Archives Suisses de Neurologie, Neurochirurgie et de Psychiatrie 1976, 118(2):199-206. 5. Ishiai S, Furukawa T, Tsukagoshi H: Visuospatial ... conditions. BioMed Central Page 1 of 6 (page number not for citation purposes) Journal of NeuroEngineering and Rehabilitation Open Access Research Simulating hemispatial neglect with virt...

Ngày tải lên: 19/06/2014, 10:20

... performances of systems with ideal channel param- eters, 7-tap layerwise estimator with optimum transform, as defined in (27), and 10-tap layerwise DFT-based estimator with significant tap selection ... blocks of data are transmitted with 1 training block sent every 10 blocks. The performance averaged over independent sim- ulations is e valuated. For channel estimator with subspace tr...

Ngày tải lên: 23/06/2014, 01:20

... type L2 gene (FN297862) using HPV16 L2 F (CC GGATCCGCCAC- CATG GCCAGCGCCACCCAGCTG) and HPV16 L2Δ R ( GTCGACCATGTAGTAGCTGGGGTGCAGGATG). A forward primer w as designed to introduce a BamHI site, and ... all mice immunized with the LIL2 VLPs (group 5), with a GMT of 1,100. Anti-L2 antibodies w ere detected at similar levels in mice immunized with control PsV (groups 6 and 7), with GMTs o...

Ngày tải lên: 18/06/2014, 16:20

... stock collagenase solution to a final concentration of 0.5 units/mL. The centrifuge tubes with the contents were placed and secured on a Thermaline shaker and incubated with constant agita- tion ... energy supply and storage in mitochondria, was notably lower in group 2 than in groups 1 and 5. The increase in cyto- solic cytochrome C content also suggested significant mitochondrial damage...

Ngày tải lên: 18/06/2014, 16:20

... http://www.hqlo.com/content/6/1/50 Page 9 of 9 (page number not for citation purposes) 15. Trojan A, Nickel S, Oppolzer A: Kombinierte Mitarbeiter- und Patientenbefragung. Universitätsklinikum Hamburg-Eppendorf ... Medizin-Soziologie 2001. Hand- out 1 16. Pfaff H, Freise DC, Mager G, Schrappe M: Der Kölner Patienten- fragebogen (KPF): Entwicklung und Validierung eines Frage- bogens zur Erfass...

Ngày tải lên: 18/06/2014, 19:20

... an unexpected visitor may arrive. Gal- lagher and MacLachlan noted that the common senti- ment of the participants is to appear a nd be ‘ normal’ again. With regard to social interactions, many ... similar circumstances and with limited alter- natives for replacement limbs, it is understandable that depression can be one of the conditions associated with limb loss. Gallag her and MacLac...

Ngày tải lên: 19/06/2014, 08:20

... http://www.jneuroengrehab.com/content/2/1/14 Page 8 of 10 (page number not for citation purposes) The personal customization process has been ensured with the wearable unit. In our experiments, ... γ ARV-MPF. BioMed Central Page 1 of 10 (page number not for citation purposes) Journal of NeuroEngineering and Rehabilitation Open Access Research Personal customizing exercise with a wearable...

Ngày tải lên: 19/06/2014, 10:20

... and a virtual marker consisting of the average location of the right and left hip markers), and the head with respect to trunk. These data were averaged across the 3 trials of each visual condition. ... Statistical comparisons were performed within subjects and across scene velocities with the Wil- coxon matched pairs test. HS and VS subjects were com- pared with the Wilcoxon signed ran...

Ngày tải lên: 19/06/2014, 10:20

... coordination training with or without SR stimulation on static postural stability of subjects with FAI. Methods Subjects Sixteen females and fourteen males (177 ± 10 cm, 76 ± 16 kg, 21 ± 2 years) with FAI ... sensa- tions within the year prior to data collection. The majority of our subjects had mechanical instability (67% with anterior drawer laxity and 76% with talar tilt laxity)....

Ngày tải lên: 19/06/2014, 10:20

... system [4]. Once a pseudoaneurysm is diagnosed, endovascular management is the best treatment option [5]. Figure 1 Chest AP film on admission revealed cardiomegaly with widening of the mediastinum, ... (relative high density) was found (Figure 2, 3). Results were consistent with a pseudoaneurysm in the aortic arch and hemor- rhage into the pericardium. Thoracic endovascular aneurysm repai...

Ngày tải lên: 20/06/2014, 00:20