Báo cáo hóa học: "Clinically important improvement in the WO

Báo cáo hóa học: "Clinically important improvement in the WOMAC and predictor factors for response to non-specific non-steroidal anti-inflammatory drugs in osteoarthritic patients: a prospective study" docx

... latifatahiri@yahoo.fr Hamza Khazzani, Aff1 Email: hamzakhazzani@yahoo.fr Leila El Mansouri, Aff1 Email: la_mansouri1@yahoo.fr Sanae Ali Ou Alla, Aff1 Email: sanae.alioualla@yahoo.fr Redouane ... doi:10.1186/1756-0500-5-58 Ihsane Hmamouchi (i.hmamouchi@yahoo.fr) Fadoua Allali (fadouaallali@yahoo.fr) Latifa Tahiri (latifatahiri@yahoo.fr) Hamza Khazzani (hamzakhazzani@yahoo.fr) Leila E...

Ngày tải lên : 21/06/2014, 19:20

22
392
0

báo cáo hóa học:" Survivin gene levels in the peripheral blood of patients with gastric cancer independently predict survival" doc

... purposes) lected the clinical data of patients. RS handled samples collection and storage until RNA extraction. DN coordi- nated the study and participated in manuscript writing and editing. All authors read ... gastric carcinoma cell line derived from a liver metastasis of a well differentiated carcinoma of the stomach taken prior to cytotoxic therapy. According to the...

Ngày tải lên : 18/06/2014, 15:20

8
565
0

báo cáo hóa học: " Type D personality in the general population: a systematic review of health status, mechanisms of disease, and work-related problems" docx

... patients [41]. Finally, Type D was a strong predictor of adverse cardiac outcome after acute myocardial infarction, and the associated risk was similar to that of traditio nal car- diovascular ... systolic and diastolic blood pressure reactivity [11], and dampened heart rate reactivity dur- ing experimental stress. Type D was also associated with a decreased activity in the...

Ngày tải lên : 18/06/2014, 19:20

10
595
0

báo cáo hóa học: " Cognitive interviewing methodology in the development of a pediatric item bank: a patient reported outcomes measurement information system (PROMIS) study" docx

... ages 8–17 can talk about and respond to items asking them about their health and well-being. They can also offer unique insight into the understandability of the items. These findings are consistent ... clinic appointment books. A research assistant then mailed an informational letter to the child's parent to inform them about the study. Those who were interested in...

Ngày tải lên : 18/06/2014, 19:20

10
480
1

Báo cáo hóa học: " Quality of life in children three and nine months after discharge from a paediatric intensive care unit: a prospective cohort study" pdf

... is the only phys- ical aspect that is evaluated and social aspects, family functioning, and well being are not evaluated. In a fifth study the Royal Alexandra Hospital for Children (RAHC) Table ... by the parents and not the children themselves when older than eight years of age. In another Australian study the Royal Alexandra Hos- pital for Children (RAHC) Measure o...

Ngày tải lên : 18/06/2014, 22:20

9
440
0

Báo cáo hóa học: " Multi-finger coordination in healthy subjects and stroke patients: a mathematical modelling approach" potx

... normalized in time as a percen- tage of the movement duration (%Dur). Joint angle mathematical characterization and accuracy After data normalization, each joint angula r profile was mathem atically ... data, performed the statistical analysis and performed data interpretation. JJ and MF participated in data interpretation. IC wrote the manuscript. JJ and MF reviewed the...

Ngày tải lên : 19/06/2014, 08:20

20
343
0

báo cáo hóa học: " Involvement of β-chemokines in the development of inflammatory demyelination" ppt

... of the phosphoinositidine 3-kinase pathway, while the Gβγ subunits activate phospholipase C and induce Ca 2+ influx and protein kinase C activation. The involvement of MAP kinases as well as JAK/STAT ... of other inflammatory cells to the endothelial layer of the BBB. These molecular inter- actions may lead to permanent inflammatory cell immi- gration into the CNS in ch...

Ngày tải lên : 19/06/2014, 22:20

14
421
0

báo cáo hóa học: " Correction: Microglial inflammation in the parkinsonian substantia nigra: relationship to alpha-synuclein deposition" pptx

Ngày tải lên : 19/06/2014, 22:20

1
196
0

báo cáo hóa học: " Strain-dependent variation in the early transcriptional response to CNS injury using a cortical explant system" doc

... TGTACAGAGCTCCACGGCTG CiiTA Forward GCATGTTGCACACCAGCTCCCT 135 bp NM_007575.2 major histocompatibility complex class II transactivator Reverse ACGCCAGTCTGACGAAGGTCCA COX-2 Forward CAGACAACATAAACTGCGCCTT ... Forward CCTTCCAGGATGAGGACATGA 71 bp NM_008361.3 interleukin 1 beta Reverse TGAGTCACAGAGGATGGGCTC IL-6 Forward GAGGATACCACTCCCAACAGACC 141 bp NM_031168.1 interleukin 6 Reverse AAGTGCATCATCGT...

Ngày tải lên : 19/06/2014, 22:20

8
447
0

báo cáo hóa học: " Lipopolysaccharide induced inflammation in the perivascular space in lungs" docx

... that PVS may be a unique anatomical and functional site for the migration of inflammatory cells in acute lung inflammation. Therefore, PVS may contribute to immune responses in lung inflammation ... such as anti-IL-9 agent reduce the amount of cellular infiltrates within this area [10,12]. It appears that the PVS may be an important loca- tion for the accumulation and...

Ngày tải lên : 20/06/2014, 00:20

5
363
0