Báo cáo hóa học: " Chromosomal 16p microdeletion in Rubinstein-Taybi syndrome detected by oligonucleotide-based array comparative genomic hybridization: a case report" doc

... Medicine, University of Malaya, 50603 Kuala Lumpur, Malaysia 3 Advance Medical and Dental Institute, Universiti Sains Malaysia, 13200 Kepala Batas, Pulau Pinang, Malaysia *Corresponding authors ... available soon. Chromosomal 16p microdeletion in Rubinstein-Taybi syndrome detected by oligonucleotide-based array comparative genomic hybridization: a case repo...

Ngày tải lên: 21/06/2014, 19:20

... down as the detecting area was moved up from the interface to the overlayer, and it was maintained at a large value for a long depth area. Then it went down again, and it finally increased near ... Tieying Yang 2 , Huanhua Wang 2 Abstract Cracks appeared in GaN epitaxial layers which were grown by a novel method combining metal organic vapor- phase epitaxy (MOCVD) and hydride vapor-...

Ngày tải lên: 21/06/2014, 06:20

... growth in the case of InN NWs has been explained by Vaddiraju et al. [10] who obtained InN NWs on quartz and polycrystalline AlN at a substrate temperature T S = 450 °C or heater temperature of T H = ... be very fast and most likely a non-radiative decay into defect/ surface-related states in the NWs. Furthermore, this time constant is increasing in a nonlinear fashion with in...

Ngày tải lên: 22/06/2014, 01:20

... below). For information about publishing your research in Journal of Inequalities and Applications go to http://www.journalofinequalitiesandapplications.com/authors/instructions/ For information about ... (2004) [16] Edwards, RE, Measure, Functional Analysis Theory and Applications. Holt, Rinehart and Win- ston, New York (1965) [17] Ash, RB: Measure, Integration and Functional Analysis. Aca...

Ngày tải lên: 18/06/2014, 15:20

... Parent A, Hazrati LN: Functional anatomy of the basal ganglia. Part I: The cortico-basal ganglia-thalamo-cortical loop. Brain Res Rev 1995, 20:91-127. 36. Takada M, Hattori T: Glycine: an alternative ... can not differentiate among increasing the maximal conductance of an individual channel, increas- ing the number of channels, or increasing the probability that a channel is open. Any comb...

Ngày tải lên: 18/06/2014, 15:20

... province), Yin- chuan School for the Blind, Deaf and Dumb (Ningxia Province), Xining Spe- cial Education School (Qinghai province), Changan School for the Deaf and Dumb (Shaanxi province), Affiliated ... also ana- lyzed for mutations in Exon1 and flanking introns by PCR/sequencing. The PCR primers used are forward primer: 5'CTCATGGGGGCTCAAAGGAACTAGGAGATCGG3' and reverse primer...

Ngày tải lên: 18/06/2014, 15:20

... different kind of cancer, but the available data are scarce [18,19]. In a series of 26 gastric cancer patients, Survivin mRNA (as measured by means of ELISA-based qrtPCR) in the peripheral blood has ... Yokobori T, Hirasaki S, Takatsuno Y, Sakashita H, Ishii H, et al.: A large-scale study of MT1-MMP as a marker for isolated tumor cells in peripheral blood and bone marrow in ga...

Ngày tải lên: 18/06/2014, 15:20

... cytometry using a FACS Calibur (BD). Statistical analysis Statistical analysis was performed with StatsDirect soft- ware using Log rank analysis for comparing mouse sur- vival data, and a Mann-Whitney ... Mapatumumab, an Antibody Targeting TRAIL-R1, in Combination With Paclitaxel and Carboplatin in Patients With Advanced Solid Malignancies: Results of a Phase I and Pharmacokineti...

Ngày tải lên: 18/06/2014, 16:20

... study and participated in its design and coordi- nation and helped in interpretation of data and drafting the manuscript. TKS made contribution to statistical analysis and interpretation of data and ... DNA solutions have indicated that metallo-phthalocyanines can induce significant numbers of DNA strand-breaks [30]. Single strand DNA breaks and mutagenicity induced by photodynamic acti...

Ngày tải lên: 18/06/2014, 16:20

... such as visualizing MAGEA3 differential expression between basal cell carcinoma and metastatic carcinoma samples (a- c). Szalma et al. Journal of Translational Medicine 2010, 8:68 http://www.translational-medicine.com/content/8/1/68 Page ... expression, etc) and areas (clinical and pre-clinical) are aligned to standard ontologies and curated and undergo ETL processing to be stored in a ce...

Ngày tải lên: 18/06/2014, 16:20