báo cáo hóa học:" SimReg1 is a master switch for biosynthesis and export of simocyclinone D8 and its precursors" docx

báo cáo hóa học:" SimReg1 is a master switch for biosynthesis and export of simocyclinone D8 and its precursors" docx

báo cáo hóa học:" SimReg1 is a master switch for biosynthesis and export of simocyclinone D8 and its precursors" docx

... P A7 simA7R ATAAGCTTGTCGATACCGATCTTC PEx2F ACTTCCCAGAAGTA DNA-shift assay P Ex2 PEx2R AGAGGGCAGTAGAC PR3F TTTCTAGATGCACCCGATCCTC DNA-shift assay P SR3 PR3R GAACAGGATTCGCATGAGTACT D 4For TATTGGTCGCGCAGTCGTCC ... TAGAATTCGCGACAGGAGCCATA simEXX4F TAGAATTCGACGCCTTCCAGTC DNA-shift assay P X4 simEXX4R TAGAATTCTCAGAACATCGTCC SR2ExXF AAATCTAGATCAAGCCAGTGCTG DNA-shift assay P R2Ex SR2ExXR TTTGAATTC...

Ngày tải lên: 21/06/2014, 17:20

12 455 0
Báo cáo hóa học: " Research Article A Hybrid Technique for the Periodicity Characterization of Genomic Sequence Data" ppt

Báo cáo hóa học: " Research Article A Hybrid Technique for the Periodicity Characterization of Genomic Sequence Data" ppt

... Silverman and R. Linsker, A measure of DNA periodic- ity,” Journal of Theoretical Biology, vol. 118, no. 3, pp. 295–300, 1986. [23] S. Tiwari, S. Ramachandran, A. Bhattacharya, S. Bhattacharya, and ... 105–115, 2002. [6] N. Chakravarthy, A. Spanias, L. D. Iasemidis, and K. Tsakalis, “Autoregressive modeling and feature analysis of DNA sequences,” EURASIP Journal on Applied Si...

Ngày tải lên: 22/06/2014, 00:20

8 382 0
Báo cáo hóa học: " Research Article Burst Format Design for Optimum Joint Estimation of Doppler-Shift and Doppler-Rate in Packet Satellite Communications" ppt

Báo cáo hóa học: " Research Article Burst Format Design for Optimum Joint Estimation of Doppler-Shift and Doppler-Rate in Packet Satellite Communications" ppt

... phase/Doppler-shift and of the Doppler-rate are derived, and a data-aided (DA) estimation algorithm suitable for each optimal burst format is presented. Performance of the newly derived estimators ... are not directly applicable to a burst format encompassing a preamble and a postamble. In addi- tion, straightforward solution of a maximum-likelihood es- timation prob...

Ngày tải lên: 22/06/2014, 19:20

12 383 0
báo cáo hóa học:" Chloroquine is a potent inhibitor of SARS coronavirus infection and spread" docx

báo cáo hóa học:" Chloroquine is a potent inhibitor of SARS coronavirus infection and spread" docx

... review and interpretation of data and critical review of the manuscript. All authors read and approved the content of the manuscript. Acknowledgements We thank Claudia Chesley and Jonathan Towner for ... Seidah 2 and Stuart T Nichol* 1 Address: 1 Special Pathogens Brach, Division of Viral and Rickettsial Diseases, Centers for Disease Control and Prevention, 1600 Cl...

Ngày tải lên: 20/06/2014, 04:20

10 302 0
báo cáo hóa học:" HIV is a virus, not a crime: ten reasons against criminal statutes and criminal prosecutions" potx

báo cáo hóa học:" HIV is a virus, not a crime: ten reasons against criminal statutes and criminal prosecutions" potx

... are already marginalized, such as sex work- ers and drug users, are placed at risk of further targeting by government officials and agencies. This targeting is made more acute by the fact that, ... weapons of fear and blame and recrimination, criminalisation makes it more difficult for those with or at risk of HIV to access testing, to talk about diagnosis with HIV, and to...

Ngày tải lên: 20/06/2014, 08:20

7 260 0
Báo cáo hóa học: "Exhaustive expansion: A novel technique for analyzing complex data generated by higherorder polychromatic flow cytometry experiments" pot

Báo cáo hóa học: "Exhaustive expansion: A novel technique for analyzing complex data generated by higherorder polychromatic flow cytometry experiments" pot

... reevaluate the basis of human disease, while advocates of cytomics [6,7] observe that exhaustive bioinformatics data extraction avoids the inadvertent loss of information associated with a priori ... and EBW analyzed and interpreted the data. JCS and EBW wrote the manuscript. All authors have read and approved the final manuscript. Competing interests JCS is Founder and Pr...

Ngày tải lên: 18/06/2014, 16:20

15 476 0
Báo cáo hóa học: "Core strength: A new model for injury prediction and prevention" pptx

Báo cáo hóa học: "Core strength: A new model for injury prediction and prevention" pptx

... Functional Movement Screen Data was coded using Stata 8.0. For exploratory data anal- ysis we used bivariate methods. The primary hypothesis was assessed with multivariate analysis (logistic and ... of Tucson Fire Department for their par- ticipation, and its administration for funding this study, and Seamus Rogan, Jerry Poplin and Margaret Spencer of the Environmental Oc...

Ngày tải lên: 20/06/2014, 00:20

9 468 0
Báo cáo hóa học: " TSaT-MUSIC: a novel algorithm for rapid and accurate ultrasonic 3D localization" pdf

Báo cáo hóa học: " TSaT-MUSIC: a novel algorithm for rapid and accurate ultrasonic 3D localization" pdf

... MC Vanderveen, Joint angle and delay estimation (JADE) for multipath signals arriving at an antenna array. IEEE Commun Lett. 1(12) (1997) 11. A Fujita, T Fukue, N Hamada, Both direction and time ... interval of the subcar- riers, a i is the amplitude of the ith carrier, and j i is its initial phase. In this simulation, all the subcarriers have the same amplitude, and t...

Ngày tải lên: 20/06/2014, 22:20

8 432 0
báo cáo hóa học: " TCP NCE: A unified solution for non-congestion events to improve the performance of TCP over wireless networks" docx

báo cáo hóa học: " TCP NCE: A unified solution for non-congestion events to improve the performance of TCP over wireless networks" docx

... retransmissions and thereby increase the perfor- mance of TCP over wireless networks. List of Abbreviations ACL: accuracy of congestion loss; ARL: accuracy of random loss; APR: accuracy of packet ... using an algorithm that samples one RTT p er window of data. The reason is, in the presence of spurious fast retransmits, TCP is likely to have to discard most of its pote...

Ngày tải lên: 21/06/2014, 02:20

20 562 0
Báo cáo hóa học: " Research Article A Novel Image Compression Method Based on Classified Energy and Pattern Building Blocks Umit Guz" ppt

Báo cáo hóa học: " Research Article A Novel Image Compression Method Based on Classified Energy and Pattern Building Blocks Umit Guz" ppt

... Still Image Data Compression Standard, Van Nostrand Reinhold, New York, NY, USA, 1992. [12] K. R. Rao and P. Yip, Discrete Cosine Transform: Algorithms, Advantages, and Applications, Academic ... University of California at Berkeley, CA, USA and the researchers in the SRI International, Speech Technology and Research (STAR) Laboratory, Menlo Park, CA, USA for many helpful discussi...

Ngày tải lên: 21/06/2014, 05:20

20 440 0
w